Human CNPY2(Canopy 2 Homolog) ELISA Kit

Human CNPY2(Canopy 2 Homolog) ELISA Kit

Human Canopy 2 Homolog (CNPY2) ELISA Kit

RD-CNPY2-Hu-96Tests 96 Tests
EUR 783

Human Canopy 2 Homolog (CNPY2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Human Canopy 2 Homolog (CNPY2) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Canopy 2 Homolog elisa. Alternative names of the recognized antigen: ZSIG9
  • Cnpy2
  • MSAP
  • TMEM4
  • Transmembrane Protein 4
  • MIR-interacting saposin-like protein
  • Putative secreted protein Zsig9
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Canopy 2 Homolog (CNPY2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Canopy 2 Homolog (CNPY2) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Canopy 2 Homolog (CNPY2)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y2B0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.1kDa
  • Isoelectric Point: 5.4
Description: Recombinant Human Canopy 2 Homolog expressed in: E.coli

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

SEM449Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Canopy 2 Homolog (CNPY2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Canopy 2 Homolog (CNPY2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Canopy 2 Homolog (CNPY2) ELISA Kit

  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Canopy 2 Homolog elisa. Alternative names of the recognized antigen: ZSIG9
  • Cnpy2
  • MSAP
  • TMEM4
  • Transmembrane Protein 4
  • MIR-interacting saposin-like protein
  • Putative secreted protein Zsig9
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Canopy 2 Homolog (CNPY2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Protein canopy homolog 2 (CNPY2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 45.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein canopy homolog 2(CNPY2) expressed in E.coli

Human Canopy 2 Homolog (CNPY2) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Canopy 2 Homolog (CNPY2) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human CNPY2 (Canopy 2 Homolog)

ELK7033 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Canopy 2 Homolog (CNPY2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Canopy 2
  • Show more
Description: A sandwich ELISA kit for detection of Canopy 2 Homolog from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Protein canopy homolog 2, CNPY2 ELISA KIT

ELI-33716h 96 Tests
EUR 824

Canopy 2 Homolog (CNPY2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 2 Homolog (CNPY2) Antibody Pair

abx117460-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Mouse Canopy 2 Homolog (CNPY2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Canopy 2 Homolog (CNPY2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Canopy 2 Homolog (CNPY2) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Protein canopy homolog 2, Cnpy2 ELISA KIT

ELI-10845m 96 Tests
EUR 865

ELISA kit for Mouse CNPY2 (Canopy 2 Homolog)

ELK8075 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Canopy 2 Homolog (CNPY2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Canopy 2
  • Show more
Description: A sandwich ELISA kit for detection of Canopy 2 Homolog from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2)

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with APC.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with Biotin.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with Cy3.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with FITC.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with HRP.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with PE.

Canopy 2 Homolog (CNPY2) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNPY2 (Arg21~Leu182)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Canopy 2 Homolog (CNPY2). This antibody is labeled with APC-Cy7.

Human Canopy 3 Homolog (CNPY3) ELISA Kit

abx386611-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Canopy 4 Homolog (CNPY4) ELISA Kit

abx386612-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Protein canopy homolog 2 Polyclonal Antibody

42421-100ul 100ul
EUR 333

Human Protein canopy homolog 3(CNPY3) ELISA kit

E01P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein canopy homolog 3(CNPY3) ELISA kit

E01P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein canopy homolog 3(CNPY3) ELISA kit

E01P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein canopy homolog 1, CNPY1 ELISA KIT

ELI-10076h 96 Tests
EUR 824

Human Protein canopy homolog 4, CNPY4 ELISA KIT

ELI-33026h 96 Tests
EUR 824

Human Protein canopy homolog 3, CNPY3 ELISA KIT

ELI-51011h 96 Tests
EUR 824

Canopy 3 Homolog Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Protein canopy homolog 2 Polyclonal Conjugated Antibody

C42421 100ul
EUR 397

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit

E04P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit

E04P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit

E04P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein canopy homolog 3(CNPY3) ELISA kit

E02P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein canopy homolog 3(CNPY3) ELISA kit

E02P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein canopy homolog 3(CNPY3) ELISA kit

E02P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 3(CNPY3) ELISA kit

E03P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 3(CNPY3) ELISA kit

E03P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 3(CNPY3) ELISA kit

E03P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein canopy homolog 3(CNPY3) ELISA kit

E06P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein canopy homolog 3(CNPY3) ELISA kit

E06P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protein canopy homolog 3(CNPY3) ELISA kit

E06P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein canopy homolog 3(CNPY3) ELISA kit

E08P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein canopy homolog 3(CNPY3) ELISA kit

E08P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protein canopy homolog 3(CNPY3) ELISA kit

E08P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein canopy homolog 3(CNPY3) ELISA kit

E07P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein canopy homolog 3(CNPY3) ELISA kit

E07P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protein canopy homolog 3(CNPY3) ELISA kit

E07P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein canopy homolog 3(CNPY3) ELISA kit

E09P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein canopy homolog 3(CNPY3) ELISA kit

E09P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protein canopy homolog 3(CNPY3) ELISA kit

E09P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 1, Cnpy1 ELISA KIT

ELI-09145m 96 Tests
EUR 865

Mouse Protein canopy homolog 4, Cnpy4 ELISA KIT

ELI-10077m 96 Tests
EUR 865

Porcine Protein canopy homolog 3, CNPY3 ELISA KIT

ELI-10589p 96 Tests
EUR 928

Bovine Protein canopy homolog 4, CNPY4 ELISA KIT

ELI-10846b 96 Tests
EUR 928

Mouse Protein canopy homolog 3, Cnpy3 ELISA KIT

ELI-25933m 96 Tests
EUR 865

Bovine Protein canopy homolog 3, CNPY3 ELISA KIT

ELI-50327b 96 Tests
EUR 928

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 98.00
  • EUR 133.00
  • EUR 523.00
  • 10 ul
  • 20 ul
  • 400 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

abx030445-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 4 Homolog (CNPY4) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

abx231816-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Canopy 4 Homolog (CNPY4) Antibody

abx231817-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CNPY3 Canopy 3 Homolog Human Recombinant Protein

PROTQ9BT09 Regular: 20ug
EUR 317
Description: CNPY3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 271 amino acids (31-278 a.a.) and having a molecular mass of 29.9kDa. CNPY3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit

E05P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit

E05P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Protein canopy homolog 3(CNPY3) ELISA kit

E05P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Canopy 4 Homolog (CNPY4) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 4 Homolog (CNPY4) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Canopy 4 Homolog (CNPY4) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


EF008766 96 Tests
EUR 689

CNPY2 ELISA Kit (Human) (OKCD00621)

OKCD00621 96 Wells
EUR 909
Description: Description of target: Positive regulator of neurite outgrowth by stabilizing myosin regulatory light chain (MRLC). It prevents MIR-mediated MRLC ubiquitination and its subsequent proteasomal degradation. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL

CNPY2 ELISA Kit (Human) (OKDD00196)

OKDD00196 96 Wells
EUR 1053
Description: Description of target: Positive regulator of neurite outgrowth by stabilizing myosin regulatory light chain (MRLC). It prevents MIR-mediated MRLC ubiquitination and its subsequent proteasomal degradation.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Cnpy2 ELISA Kit (Mouse) (OKCD02073)

OKCD02073 96 Wells
EUR 936
Description: Description of target: Positive regulator of neurite outgrowth by stabilizing myosin regulatory light chain (MRLC). It prevents MIR-mediated MRLC ubiquitination and its subsequent proteasomal degradation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

CNPY2 antibody

70R-21486 50 ul
EUR 435
Description: Rabbit polyclonal CNPY2 antibody

CNPY2 antibody

70R-15364 100 ug
EUR 327
Description: Rabbit polyclonal CNPY2 antibody

CNPY2 Antibody

42954-100ul 100ul
EUR 252

CNPY2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CNPY2. Recognizes CNPY2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CNPY2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNPY2. Recognizes CNPY2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

CNPY2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0477803 1.0 ug DNA
EUR 154

Human CNPY2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CNPY2 Recombinant Protein (Human)

RP007531 100 ug Ask for price

Human Slit Homolog 2 ELISA kit

E01S0112-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Slit Homolog 2 ELISA kit

E01S0112-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Slit Homolog 2 ELISA kit

E01S0112-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Slit Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CNPY2 Rabbit pAb

A12197-100ul 100 ul
EUR 308

CNPY2 Rabbit pAb

A12197-200ul 200 ul
EUR 459

CNPY2 Rabbit pAb

A12197-20ul 20 ul
EUR 183

CNPY2 Rabbit pAb

A12197-50ul 50 ul
EUR 223

CNPY2 antibody (HRP)

60R-1906 100 ug
EUR 327
Description: Rabbit polyclonal CNPY2 antibody (HRP)

CNPY2 antibody (FITC)

60R-1907 100 ug
EUR 327
Description: Rabbit polyclonal CNPY2 antibody (FITC)

CNPY2 antibody (biotin)

60R-1908 100 ug
EUR 327
Description: Rabbit polyclonal CNPY2 antibody (biotin)

CNPY2 cloning plasmid

CSB-CL896486HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 549
  • Sequence: atgaaaggctggggttggctggccctgcttctgggggccctgctgggaaccgcctgggctcggaggagccaggatctccactgtggagcatgcagggctctggtggatgaactagaatgggaaattgcccaggtggaccccaagaagaccattcagatgggatctttccggatcaa
  • Show more
Description: A cloning plasmid for the CNPY2 gene.

CNPY2,MSAP Antibody

DF12367 200ul
EUR 304
Description: CNPY2,MSAP antibody detects endogenous levels of CNPY2,MSAP.

CNPY2 Conjugated Antibody

C42954 100ul
EUR 397

CNPY2, MSAP Antibody

abx231814-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CNPY2,MSAP Antibody

abx231815-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CNPY2 Polyclonal Antibody

A53985 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-CNPY2 antibody

STJ11100878 100 µl
EUR 413

Anti-CNPY2 antibody

STJ114089 100 µl
EUR 277

Anti-CNPY2 antibody

STJ13100106 100 µl
EUR 427

CNPY2 ORF Vector (Human) (pORF)

ORF002511 1.0 ug DNA
EUR 95

human snail homolog 2,SNAI2 ELISA Kit

201-12-1878 96 tests
EUR 440
  • This snail homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Frizzled Homolog 2 (FZD2)ELISA Kit

201-12-2370 96 tests
EUR 440
  • This Frizzled Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Chromobox Homolog 2 (CBX2)ELISA Kit

201-12-2895 96 tests
EUR 440
  • This Chromobox Homolog 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Hu-48T 48T
EUR 479
  • Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit

DLR-Slit2-Hu-96T 96T
EUR 621
  • Should the Human Slit Homolog 2 (Slit2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Slingshot Homolog 2 (SSH2) ELISA Kit

DLR-SSH2-Hu-48T 48T
EUR 517
  • Should the Human Slingshot Homolog 2 (SSH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 2 (SSH2) in samples from tissue homogenates or other biological fluids.

Human Slingshot Homolog 2 (SSH2) ELISA Kit

DLR-SSH2-Hu-96T 96T
EUR 673
  • Should the Human Slingshot Homolog 2 (SSH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 2 (SSH2) in samples from tissue homogenates or other biological fluids.

Human Notch Homolog 2 (NOTCH2) ELISA Kit

EUR 554
  • Should the Human Notch Homolog 2 (NOTCH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Notch Homolog 2 (NOTCH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Notch Homolog 2 (NOTCH2) ELISA Kit

EUR 725
  • Should the Human Notch Homolog 2 (NOTCH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Notch Homolog 2 (NOTCH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human DAB2/ Disabled homolog 2 ELISA Kit

E0655Hu 1 Kit
EUR 571

Human Anterior Gradient Homolog 2 ELISA kit

E01A0457-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Anterior Gradient Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anterior Gradient Homolog 2 ELISA kit

E01A0457-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Anterior Gradient Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Anterior Gradient Homolog 2 ELISA kit

E01A0457-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Anterior Gradient Homolog 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 2(CRB2) ELISA kit

E01C2039-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 2(CRB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 2(CRB2) ELISA kit

E01C2039-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 2(CRB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 2(CRB2) ELISA kit

E01C2039-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 2(CRB2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 2 (NOTCH2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Slingshot Homolog 2 (SSH2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Slit Homolog 2 (Slit2) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Slit Homolog 2 (Slit2) ELISA Kit

abx253953-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Frizzled Homolog 2 (FZD2) ELISA Kit

abx259574-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ovostatin homolog 2 (OVOS2) ELISA Kit

abx251888-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ELISA kit for Human Ovostatin homolog 2

EK5050 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ovostatin homolog 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human OVOS2(Ovostatin homolog 2) ELISA Kit

EH2517 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q6IE36
  • Alias: OVOS2/Ovostatin homolog 2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

ELISA kit for Human Disabled homolog 2

EK4306 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human OVOS2/ Ovostatin homolog 2 ELISA Kit

E1845Hu 1 Kit
EUR 605

Human DAB2(Disabled homolog 2) ELISA Kit

EH2115 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P98082
  • Alias: Disabled-2/DOC2/Differentially-expressed protein 2/disabled(Drosophila) homolog 2(mitogen-responsive phosphoprotein)/disabled homolog 2, mitogen-responsive phosphoprotein(Drosophila)/DOC-2DOC2
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Crumbs homolog 2, CRB2 ELISA KIT

ELI-09332h 96 Tests
EUR 824

Human Nanos homolog 2, NANOS2 ELISA KIT

ELI-20657h 96 Tests
EUR 824

Human Ovostatin homolog 2, OVOS2 ELISA KIT

ELI-22091h 96 Tests
EUR 824

Human Teashirt homolog 2, TSHZ2 ELISA KIT

ELI-29057h 96 Tests
EUR 824

Human Roundabout homolog 2, ROBO2 ELISA KIT

ELI-30174h 96 Tests
EUR 824

Human Pygopus homolog 2, PYGO2 ELISA KIT

ELI-30537h 96 Tests
EUR 824

Human Disabled homolog 2, DAB2 ELISA KIT

ELI-06821h 96 Tests
EUR 824

Human Dachshund homolog 2, DACH2 ELISA KIT

ELI-25835h 96 Tests
EUR 824

Human Tribbles homolog 2, TRIB2 ELISA KIT

ELI-51152h 96 Tests
EUR 824

Human Pumilio homolog 2, PUM2 ELISA KIT

ELI-45477h 96 Tests
EUR 824

Human snail homolog 2, SNAI2 ELISA Kit

CSB-E11753h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human snail homolog 2, SNAI2 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human snail homolog 2, SNAI2 ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human snail homolog 2, SNAI2 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tribbles Homolog 2 (TRIB2) ELISA Kit

abx383918-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Polyhomeotic Homolog 2 (PHC2) ELISA Kit

abx382190-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Chromobox Homolog 2 (CBX2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Dachshund Homolog 2 (DACH2) ELISA Kit

abx386786-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human snail homolog 2(SNAI2)ELISA Kit

GA-E1894HM-48T 48T
EUR 289

Human snail homolog 2(SNAI2)ELISA Kit

GA-E1894HM-96T 96T
EUR 466

Human Slit Homolog 2(Slit2)ELISA Kit

GA-E0678HM-48T 48T
EUR 289

Human Slit Homolog 2(Slit2)ELISA Kit

GA-E0678HM-96T 96T
EUR 466

Human Dapper homolog 2, DACT2 ELISA KIT

ELI-32114h 96 Tests
EUR 824

Human snail homolog 2(SNAI2)ELISA Kit

QY-E01031 96T
EUR 361

Human Chromobox Homolog 2(CBX2)ELISA Kit

QY-E01795 96T
EUR 361

Human Frizzled Homolog 2(FZD2)ELISA Kit

QY-E02705 96T
EUR 361

Human Slit Homolog 2(Slit2)ELISA Kit

QY-E04587 96T
EUR 361

Human Notch Homolog 2 ELISA Kit (NOTCH2)

RK01949 96 Tests
EUR 521

Human Slit Homolog 2 ELISA Kit (Slit2)

RK02298 96 Tests
EUR 521

Human Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Hu-48Tests 48 Tests
EUR 478

Human Slit Homolog 2 (Slit2) ELISA Kit

RD-Slit2-Hu-96Tests 96 Tests
EUR 662

Human Slingshot Homolog 2 (SSH2) ELISA Kit

RD-SSH2-Hu-48Tests 48 Tests
EUR 521

Human Slingshot Homolog 2 (SSH2) ELISA Kit

RD-SSH2-Hu-96Tests 96 Tests
EUR 723

Human Slit Homolog 2 (Slit2) ELISA Kit

SEA672Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Slit Homolog 2 (Slit2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Slit Homolog 2 (Slit2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit

SEA672Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Slit Homolog 2 (Slit2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Slit Homolog 2 (Slit2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit

SEA672Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Slit Homolog 2 (Slit2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Slit Homolog 2 (Slit2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit

SEA672Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Slit Homolog 2 (Slit2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Slit Homolog 2 (Slit2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Slit Homolog 2 (Slit2) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Slit Homolog 2 elisa. Alternative names of the recognized antigen: SLIL3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Slit Homolog 2 (Slit2) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Notch Homolog 2 (NOTCH2) ELISA Kit

RDR-NOTCH2-Hu-48Tests 48 Tests
EUR 589

Human Notch Homolog 2 (NOTCH2) ELISA Kit

RDR-NOTCH2-Hu-96Tests 96 Tests
EUR 820

Human Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Hu-48Tests 48 Tests
EUR 500

Human Slit Homolog 2 (Slit2) ELISA Kit

RDR-Slit2-Hu-96Tests 96 Tests
EUR 692

Human Slingshot Homolog 2 (SSH2) ELISA Kit

RDR-SSH2-Hu-48Tests 48 Tests
EUR 544

Human Slingshot Homolog 2 (SSH2) ELISA Kit

RDR-SSH2-Hu-96Tests 96 Tests
EUR 756

Human Notch Homolog 2 (NOTCH2) ELISA Kit

RD-NOTCH2-Hu-48Tests 48 Tests
EUR 563

Human Notch Homolog 2 (NOTCH2) ELISA Kit

RD-NOTCH2-Hu-96Tests 96 Tests
EUR 783

Human Slingshot Homolog 2 (SSH2) ELISA Kit

SEJ455Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Slingshot Homolog 2 (SSH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Slingshot Homolog 2 (SSH2) in Tissue homogenates and other biological fluids.

Human Slingshot Homolog 2 (SSH2) ELISA Kit

SEJ455Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Slingshot Homolog 2 (SSH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Slingshot Homolog 2 (SSH2) in Tissue homogenates and other biological fluids.

Human Slingshot Homolog 2 (SSH2) ELISA Kit

SEJ455Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Slingshot Homolog 2 (SSH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Slingshot Homolog 2 (SSH2) in Tissue homogenates and other biological fluids.

Human Slingshot Homolog 2 (SSH2) ELISA Kit

SEJ455Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Slingshot Homolog 2 (SSH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Slingshot Homolog 2 (SSH2) in Tissue homogenates and other biological fluids.

Human Slingshot Homolog 2 (SSH2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Slingshot Homolog 2 elisa. Alternative names of the recognized antigen: SSH2L
  • SSH-like protein 2
  • Protein phosphatase Slingshot homolog 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Slingshot Homolog 2 (SSH2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Notch Homolog 2 (NOTCH2) ELISA Kit

SEL148Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Notch Homolog 2 (NOTCH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Notch Homolog 2 (NOTCH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Notch Homolog 2 (NOTCH2) ELISA Kit

SEL148Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Notch Homolog 2 (NOTCH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Notch Homolog 2 (NOTCH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Notch Homolog 2 (NOTCH2) ELISA Kit

SEL148Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Notch Homolog 2 (NOTCH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Notch Homolog 2 (NOTCH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Notch Homolog 2 (NOTCH2) ELISA Kit

SEL148Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Notch Homolog 2 (NOTCH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Notch Homolog 2 (NOTCH2) in Tissue homogenates, cell lysates and other biological fluids.

Human Notch Homolog 2 (NOTCH2) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Notch Homolog 2 elisa. Alternative names of the recognized antigen: AGS2
  • hN2
  • Neurogenic locus notch homolog protein 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Notch Homolog 2 (NOTCH2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cnpy2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7495703 1.0 ug DNA
EUR 154

Cnpy2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4593303 1.0 ug DNA
EUR 154

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human CNPY2(Canopy 2 Homolog) ELISA Kit