Human SP140(Sp140 Nuclear Body Protein) ELISA Kit

Human SP140(Sp140 Nuclear Body Protein) ELISA Kit

Human Sp140 Nuclear Body Protein (SP140) ELISA Kit

SEN896Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sp140 Nuclear Body Protein (SP140) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sp140 Nuclear Body Protein (SP140) in Tissue homogenates, cell lysates and other biological fluids.

Human Sp140 Nuclear Body Protein (SP140) ELISA Kit

SEN896Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sp140 Nuclear Body Protein (SP140) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: C
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sp140 Nuclear Body Protein (SP140) in Tissue homogenates, cell lysates and other biological fluids.

Human Sp140 Nuclear Body Protein (SP140) ELISA Kit

4-SEN896Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Sp140 Nuclear Body Protein elisa. Alternative names of the recognized antigen: LYSP100-B
  • LYSP100-A
  • Lymphoid-restricted homolog of Sp100
  • Nuclear autoantigen Sp-140
  • Speckled 140 kDa
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sp140 Nuclear Body Protein (SP140) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Sp140 Nuclear Body Protein (SP140) Antibody

abx027073-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sp140 Nuclear Body Protein (SP140) Antibody

abx027073-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sp140 Nuclear Body Protein (SP140) Antibody

20-abx128890
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sp140 Nuclear Body Protein (SP140) Antibody

20-abx174609
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Sp140 Nuclear Body Protein (SP140) Antibody

abx433313-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Recombinant Sp140 Nuclear Body Protein (SP140)

4-RPN896Hu01
  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13342
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.9kDa
  • Isoelectric Point: 10.3
Description: Recombinant Human Sp140 Nuclear Body Protein expressed in: E.coli

Human Sp140 Nuclear Body Protein (SP140) Protein

20-abx167879
  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Sp140 Nuclear Body Protein (SP140) CLIA Kit

20-abx496112
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human SP140 (Sp140 Nuclear Body Protein)

ELK7335 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sp140 Nuclear Body Protein (SP140). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of Sp140 Nuclear Body Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Sp140 Nuclear Body Protein (SP140) Polyclonal Antibody (Human, Rat)

4-PAN896Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SP140 (Gly443~Met655)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Sp140 Nuclear Body Protein (SP140)

Rat SP140 Nuclear Body ELISA kit

QY-E11876 96T
EUR 374

Sp140 Nuclear Body Protein (SP140) Polyclonal Antibody (Human, Rat), APC

4-PAN896Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SP140 (Gly443~Met655)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Sp140 Nuclear Body Protein (SP140). This antibody is labeled with APC.

Sp140 Nuclear Body Protein (SP140) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAN896Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SP140 (Gly443~Met655)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Sp140 Nuclear Body Protein (SP140). This antibody is labeled with Biotin.

Sp140 Nuclear Body Protein (SP140) Polyclonal Antibody (Human, Rat), Cy3

4-PAN896Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SP140 (Gly443~Met655)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Sp140 Nuclear Body Protein (SP140). This antibody is labeled with Cy3.

Sp140 Nuclear Body Protein (SP140) Polyclonal Antibody (Human, Rat), FITC

4-PAN896Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SP140 (Gly443~Met655)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Sp140 Nuclear Body Protein (SP140). This antibody is labeled with FITC.

Sp140 Nuclear Body Protein (SP140) Polyclonal Antibody (Human, Rat), HRP

4-PAN896Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SP140 (Gly443~Met655)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Sp140 Nuclear Body Protein (SP140). This antibody is labeled with HRP.

Sp140 Nuclear Body Protein (SP140) Polyclonal Antibody (Human, Rat), PE

4-PAN896Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SP140 (Gly443~Met655)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Sp140 Nuclear Body Protein (SP140). This antibody is labeled with PE.

Sp140 Nuclear Body Protein (SP140) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAN896Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SP140 (Gly443~Met655)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Sp140 Nuclear Body Protein (SP140). This antibody is labeled with APC-Cy7.

Human Nuclear body protein SP140- like protein, SP140L ELISA KIT

ELI-22736h 96 Tests
EUR 824

SP140 antibody

20R-1079 100 ug
EUR 377
Description: Rabbit polyclonal SP140 antibody

SP140 siRNA

20-abx934749
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SP140

YF-PA17551 50 ug
EUR 363
Description: Mouse polyclonal to SP140

SP140 ELISA Kit (Human) (OKCD00627)

OKCD00627 96 Wells
EUR 909
Description: Description of target: Component of the nuclear body, also known as nuclear domain 10, PML oncogenic domain, and KR body (PubMed:8910577). May be involved in the pathogenesis of acute promyelocytic leukemia and viral infection (PubMed:8910577). May play a role in chromatin-mediated regulation of gene expression although it does not bind to histone H3 tails (PubMed:24267382).1 Publication <p>Manually curated information that is based on statements in scientific articles for which there is no experimental support.</p> <p><a href="/manual/evidences#ECO:0000303">More…</a></p> Manual assertion based on opinion iniRef.2"Identification and characterization of a leukocyte-specific component of the nuclear body."_x005F_x005F_x000D_Bloch D.B., de la Monte S.M., Guigaouri P., Filippov A., Bloch K.D._x005F_x005F_x000D_J. Biol. Chem. 271:29198-29204(1996) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM SP140), VARIANT LYS-516, FUNCTION, SUBCELLULAR LOCATION, TISSUE SPECIFICITY, INDUCTION BY INTERFERON.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Identification and characterization of a leukocyte-specific component of the nuclear body."_x005F_x005F_x000D_Bloch D.B., de la Monte S.M., Guigaouri P., Filippov A., Bloch K.D._x005F_x005F_x000D_J. Biol. Chem. 271:29198-29204(1996) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM SP140), VARIANT LYS-516, FUNCTION, SUBCELLULAR LOCATION, TISSUE SPECIFICITY, INDUCTION BY INTERFERON.Ref.6"Structure of human Sp140 PHD finger: an atypical fold interacting with Pin1."_x005F_x005F_x000D_Zucchelli C., Tamburri S., Quilici G., Palagano E., Berardi A., Saare M., Peterson P., Bachi A., Musco G._x005F_x005F_x000D_FEBS J. 281:216-231(2014) [PubMed] [Europe PMC] [Abstract]Cited for: STRUCTURE BY NMR OF 687-738, FUNCTION, PHOSPHORYLATION AT THR-726, INTERACTION WITH PIN1. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL

SP140 Polyclonal Antibody

30099-100ul 100ul
EUR 252

SP140 Polyclonal Antibody

30099-50ul 50ul
EUR 187

SP140 Blocking Peptide

33R-7054 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SP140 antibody, catalog no. 20R-1079

SP140 cloning plasmid

CSB-CL623798HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2523
  • Sequence: ATGGCCCAGCAGGGCCAGCAGGGGCAGATGGCAAGTGGAGACAGCAATCTCAACTTCAGGATGGTCGCAGAGATCCAGAACGTAGAGGGTCAGAACCTGCAGGAGCAGGTTTGCCCTGAGCCCATTTTCAGGTTCTTCAGAGAAAACAAGGTGGAGATTGCAAGTGCAATAACAA
  • Show more
Description: A cloning plasmid for the SP140 gene.

SP140 Rabbit pAb

A17634-100ul 100 ul
EUR 308

SP140 Rabbit pAb

A17634-200ul 200 ul
EUR 459

SP140 Rabbit pAb

A17634-20ul 20 ul
EUR 183

SP140 Rabbit pAb

A17634-50ul 50 ul
EUR 223

Anti-SP140 antibody

STJ119692 100 µl
EUR 277
Description: This gene encodes a member of the SP100 family of proteins, which are share common domains including an N-terminal homogeneously staining region domain followed by a SP100/autoimmune regulator/NucP41/P75/deformed epidermal autoregulatory factor domain, a plant homeobox zinc finger, and a bromodomain. The encoded protein is interferon-inducible and is expressed at high levels in the nuclei of leukocytes. Variants of this gene have been associated with multiple sclerosis, Crohn's disease, and chronic lymphocytic leukemia. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]

Anti-SP140 (3F9)

YF-MA11358 100 ug
EUR 363
Description: Mouse monoclonal to SP140

Human SP140 shRNA Plasmid

20-abx957721
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SP140 Polyclonal Conjugated Antibody

C30099 100ul
EUR 397

SP140 ORF Vector (Human) (pORF)

ORF014556 1.0 ug DNA
EUR 354

Sp140 ORF Vector (Rat) (pORF)

ORF076853 1.0 ug DNA
EUR 506

Sp140 ORF Vector (Mouse) (pORF)

ORF058214 1.0 ug DNA
EUR 506

Anti-SP140 (aa29-41) antibody

STJ73073 100 µg
EUR 359

SP140 Protein Vector (Human) (pPB-C-His)

PV058221 500 ng
EUR 481

SP140 Protein Vector (Human) (pPB-N-His)

PV058222 500 ng
EUR 481

SP140 Protein Vector (Human) (pPM-C-HA)

PV058223 500 ng
EUR 481

SP140 Protein Vector (Human) (pPM-C-His)

PV058224 500 ng
EUR 481

SP140 sgRNA CRISPR Lentivector set (Human)

K2263101 3 x 1.0 ug
EUR 339

SP140 Protein Vector (Rat) (pPB-C-His)

PV307410 500 ng
EUR 1166

SP140 Protein Vector (Rat) (pPB-N-His)

PV307411 500 ng
EUR 1166

SP140 Protein Vector (Rat) (pPM-C-HA)

PV307412 500 ng
EUR 1166

SP140 Protein Vector (Rat) (pPM-C-His)

PV307413 500 ng
EUR 1166

SP140 Protein Vector (Mouse) (pPB-C-His)

PV232854 500 ng
EUR 603

SP140 Protein Vector (Mouse) (pPB-N-His)

PV232855 500 ng
EUR 603

SP140 Protein Vector (Mouse) (pPM-C-HA)

PV232856 500 ng
EUR 603

SP140 Protein Vector (Mouse) (pPM-C-His)

PV232857 500 ng
EUR 603

SP140 sgRNA CRISPR Lentivector (Human) (Target 1)

K2263102 1.0 ug DNA
EUR 154

SP140 sgRNA CRISPR Lentivector (Human) (Target 2)

K2263103 1.0 ug DNA
EUR 154

SP140 sgRNA CRISPR Lentivector (Human) (Target 3)

K2263104 1.0 ug DNA
EUR 154

Sp140 sgRNA CRISPR Lentivector set (Rat)

K6374401 3 x 1.0 ug
EUR 339

Sp140 sgRNA CRISPR Lentivector set (Mouse)

K3234001 3 x 1.0 ug
EUR 339

Polyclonal Goat Anti-SP140 Antibody (N-Terminus)

APG00953G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-SP140 (N-Terminus). This antibody is tested and proven to work in the following applications:

Monoclonal SP140 Antibody (clone 3F9), Clone: 3F9

AMM02067G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human SP140 (clone 3F9). The antibodies are raised in Mouse and are from clone 3F9. This antibody is applicable in IHC-P, E

Sp140 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6374402 1.0 ug DNA
EUR 154

Sp140 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6374403 1.0 ug DNA
EUR 154

Sp140 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6374404 1.0 ug DNA
EUR 154

Sp140 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3234002 1.0 ug DNA
EUR 154

Sp140 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3234003 1.0 ug DNA
EUR 154

Sp140 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3234004 1.0 ug DNA
EUR 154

Sp140 3'UTR Luciferase Stable Cell Line

TU119499 1.0 ml Ask for price

Sp140 3'UTR GFP Stable Cell Line

TU169499 1.0 ml Ask for price

Sp140 3'UTR Luciferase Stable Cell Line

TU221001 1.0 ml Ask for price

Sp140 3'UTR GFP Stable Cell Line

TU271001 1.0 ml Ask for price

SP140 3'UTR GFP Stable Cell Line

TU074364 1.0 ml
EUR 1521

SP140 3'UTR Luciferase Stable Cell Line

TU024364 1.0 ml
EUR 1521

Human Sp110 nuclear body protein, SP110 ELISA KIT

ELI-42449h 96 Tests
EUR 824

Human SP110 Nuclear Body Protein (SP110) ELISA Kit

abx383385-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

SP140 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV669613 1.0 ug DNA
EUR 1355

SP140 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV669617 1.0 ug DNA
EUR 1355

SP140 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV669618 1.0 ug DNA
EUR 1355

SP140 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2263105 3 x 1.0 ug
EUR 376

Mouse Sp110 nuclear body protein, Sp110 ELISA KIT

ELI-41202m 96 Tests
EUR 865

Sp110 Nuclear Body Protein Antibody

20-abx115748
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

SP140 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2263106 1.0 ug DNA
EUR 167

SP140 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2263107 1.0 ug DNA
EUR 167

SP140 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2263108 1.0 ug DNA
EUR 167

Sp140 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6374405 3 x 1.0 ug
EUR 376

Sp140 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3234005 3 x 1.0 ug
EUR 376

SP110 Nuclear Body Protein (SP110) Antibody

20-abx006990
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

SP110 Nuclear Body Protein (Sp110) Antibody

20-abx141993
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

SP110 Nuclear Body Protein (SP110) Antibody

abx238133-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SP110 Nuclear Body Protein (SP110) Antibody

20-abx302588
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SP140 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV669614 1.0 ug DNA
EUR 1355

SP140 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV669615 1.0 ug DNA
EUR 1413

SP140 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV669616 1.0 ug DNA
EUR 1413

Sp140 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6374406 1.0 ug DNA
EUR 167

Sp140 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6374407 1.0 ug DNA
EUR 167

Sp140 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6374408 1.0 ug DNA
EUR 167

Sp140 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3234006 1.0 ug DNA
EUR 167

Sp140 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3234007 1.0 ug DNA
EUR 167

Sp140 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3234008 1.0 ug DNA
EUR 167

SP110 Nuclear Body Protein (SP110) Antibody (HRP)

20-abx316032
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SP110 Nuclear Body Protein (SP110) Antibody (FITC)

20-abx316033
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SP110 Nuclear Body Protein (SP110) Antibody (Biotin)

20-abx316034
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human Ketone body(KB) ELISA Kit

QY-E05485 96T
EUR 361

Human Charged multivesicular body protein 2b ELISA kit

E01C1686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 2b ELISA kit

E01C1686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 2b ELISA kit

E01C1686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Inclusion Body Protein Extraction Kit

BS686 1kit, 10prep
EUR 106.55
  • Product category: Molecular Biology Kits/Protein - Extraction/Inclusion Bodies

Human Charged multivesicular body protein 3(VPS24) ELISA kit

E01C2474-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 3(VPS24) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 3(VPS24) ELISA kit

E01C2474-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 3(VPS24) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 3(VPS24) ELISA kit

E01C2474-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 3(VPS24) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 1a(CHMP1A) ELISA kit

E01C1683-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 1a(CHMP1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 1a(CHMP1A) ELISA kit

E01C1683-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 1a(CHMP1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 1a(CHMP1A) ELISA kit

E01C1683-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 1a(CHMP1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 1b(CHMP1B) ELISA kit

E01C1684-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 1b(CHMP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 1b(CHMP1B) ELISA kit

E01C1684-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 1b(CHMP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 1b(CHMP1B) ELISA kit

E01C1684-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 1b(CHMP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 2a(CHMP2A) ELISA kit

E01C1685-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 2a(CHMP2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 2a(CHMP2A) ELISA kit

E01C1685-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 2a(CHMP2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 2a(CHMP2A) ELISA kit

E01C1685-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 2a(CHMP2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 4a(CHMP4A) ELISA kit

E01C1687-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 4a(CHMP4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 4a(CHMP4A) ELISA kit

E01C1687-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 4a(CHMP4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 4a(CHMP4A) ELISA kit

E01C1687-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 4a(CHMP4A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 4b(CHMP4B) ELISA kit

E01C1688-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 4b(CHMP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 4b(CHMP4B) ELISA kit

E01C1688-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 4b(CHMP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 4b(CHMP4B) ELISA kit

E01C1688-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 4b(CHMP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 2b(CHMP2B) ELISA kit

E01C1689-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 2b(CHMP2B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 2b(CHMP2B) ELISA kit

E01C1689-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 2b(CHMP2B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 2b(CHMP2B) ELISA kit

E01C1689-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 2b(CHMP2B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 5(CHMP5) ELISA kit

E01C1690-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 5(CHMP5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 5(CHMP5) ELISA kit

E01C1690-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 5(CHMP5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 5(CHMP5) ELISA kit

E01C1690-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 5(CHMP5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 6(CHMP6) ELISA kit

E01C1691-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 6(CHMP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 6(CHMP6) ELISA kit

E01C1691-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 6(CHMP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 6(CHMP6) ELISA kit

E01C1691-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 6(CHMP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 7(CHMP7) ELISA kit

E01C1692-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 7(CHMP7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 7(CHMP7) ELISA kit

E01C1692-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 7(CHMP7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 7(CHMP7) ELISA kit

E01C1692-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Charged multivesicular body protein 7(CHMP7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Charged multivesicular body protein 5, CHMP5 ELISA KIT

ELI-10645h 96 Tests
EUR 824

Human Charged multivesicular body protein 6, CHMP6 ELISA KIT

ELI-25482h 96 Tests
EUR 824

Human Charged multivesicular body protein 3, VPS24 ELISA KIT

ELI-25637h 96 Tests
EUR 824

Human Charged Multivesicular Body Protein 3 (CHMP3) ELISA Kit

abx384239-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Telomerase Cajal body protein 1 (WRAP53) ELISA Kit

abx384315-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Charged Multivesicular Body Protein 1a (CHMP1A) ELISA Kit

abx386503-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Charged Multivesicular Body Protein 1b (CHMP1B) ELISA Kit

abx386504-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Charged Multivesicular Body Protein 2a (CHMP2A) ELISA Kit

abx386505-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Charged Multivesicular Body Protein 2b (CHMP2B) ELISA Kit

abx386506-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Charged Multivesicular Body Protein 4b (CHMP4B) ELISA Kit

abx386507-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Charged Multivesicular Body Protein 6 (CHMP6) ELISA Kit

abx386508-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Charged Multivesicular Body Protein 7 (CHMP7) ELISA Kit

abx386509-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Charged multivesicular body protein 4b, CHMP4B ELISA KIT

ELI-33485h 96 Tests
EUR 824

Human Charged multivesicular body protein 7, CHMP7 ELISA KIT

ELI-33486h 96 Tests
EUR 824

Human Charged multivesicular body protein 1b, CHMP1B ELISA KIT

ELI-33701h 96 Tests
EUR 824

Human Charged multivesicular body protein 4a, CHMP4A ELISA KIT

ELI-33702h 96 Tests
EUR 824

Human Charged multivesicular body protein 4c, CHMP4C ELISA KIT

ELI-33908h 96 Tests
EUR 824

Human Telomerase Cajal body protein 1, WRAP53 ELISA KIT

ELI-40221h 96 Tests
EUR 824

Human Charged multivesicular body protein 2b, CHMP2B ELISA KIT

ELI-50082h 96 Tests
EUR 824

Human Charged multivesicular body protein 2a, CHMP2A ELISA KIT

ELI-50761h 96 Tests
EUR 824

Human Charged multivesicular body protein 1a, CHMP1A ELISA KIT

ELI-50816h 96 Tests
EUR 824

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Rat Charged multivesicular body protein 2b ELISA kit

E02C1686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Charged multivesicular body protein 2b ELISA kit

E02C1686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Charged multivesicular body protein 2b ELISA kit

E02C1686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Charged multivesicular body protein 2b ELISA kit

E03C1686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Charged multivesicular body protein 2b ELISA kit

E03C1686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Charged multivesicular body protein 2b ELISA kit

E03C1686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Charged multivesicular body protein 2b ELISA kit

E06C1686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Charged multivesicular body protein 2b ELISA kit

E06C1686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Charged multivesicular body protein 2b ELISA kit

E06C1686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Charged multivesicular body protein 2b ELISA kit

E04C1686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Charged multivesicular body protein 2b ELISA kit

E04C1686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Charged multivesicular body protein 2b ELISA kit

E04C1686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Charged multivesicular body protein 2b ELISA kit

E07C1686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Charged multivesicular body protein 2b ELISA kit

E07C1686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Charged multivesicular body protein 2b ELISA kit

E07C1686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Charged multivesicular body protein 2b ELISA kit

E09C1686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Charged multivesicular body protein 2b ELISA kit

E09C1686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Charged multivesicular body protein 2b ELISA kit

E09C1686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Charged multivesicular body protein 2b ELISA kit

E08C1686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Charged multivesicular body protein 2b ELISA kit

E08C1686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Charged multivesicular body protein 2b ELISA kit

E08C1686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Charged multivesicular body protein 2b in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Multivesicular body subunit 12A, FAM125A ELISA KIT

ELI-09570h 96 Tests
EUR 824

Human Multivesicular body subunit 12B, FAM125B ELISA KIT

ELI-48525h 96 Tests
EUR 824

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Wrap53 ELISA Kit| Rat Telomerase Cajal body protein 1 ELISA Kit

EF019476 96 Tests
EUR 689

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human Nuclear Matrix Protein 66 ELISA kit

E01N0031-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Matrix Protein 66 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear Matrix Protein 66 ELISA kit

E01N0031-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Matrix Protein 66 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear Matrix Protein 66 ELISA kit

E01N0031-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear Matrix Protein 66 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear matrix protein 22 ELISA kit

E01N0590-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear matrix protein 22 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear matrix protein 22 ELISA kit

E01N0590-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear matrix protein 22 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear matrix protein 22 ELISA kit

E01N0590-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear matrix protein 22 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear matrix protein 22 ELISA Kit

ELA-E1095h 96 Tests
EUR 824

Human Nuclear protein 1, NUPR1 ELISA KIT

ELI-13386h 96 Tests
EUR 824

Human Nuclear protein MDM1, MDM1 ELISA KIT

ELI-20467h 96 Tests
EUR 824

Human Mdm1 Nuclear Protein (MDM1) ELISA Kit

abx381384-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Nuclear factor ELISA kit

E01N0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear factor ELISA kit

E01N0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nuclear factor ELISA kit

E01N0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Nuclear factor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

WRAP53 ELISA Kit| Bovine Telomerase Cajal body protein 1 ELISA

EF012023 96 Tests
EUR 689

Rat Charged multivesicular body protein 1a(CHMP1A) ELISA kit

E02C1683-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 1a(CHMP1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Charged multivesicular body protein 1a(CHMP1A) ELISA kit

E02C1683-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 1a(CHMP1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Charged multivesicular body protein 1a(CHMP1A) ELISA kit

E02C1683-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 1a(CHMP1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Charged multivesicular body protein 1b(CHMP1B) ELISA kit

E02C1684-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 1b(CHMP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Charged multivesicular body protein 1b(CHMP1B) ELISA kit

E02C1684-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 1b(CHMP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Charged multivesicular body protein 1b(CHMP1B) ELISA kit

E02C1684-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 1b(CHMP1B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Charged multivesicular body protein 2a(CHMP2A) ELISA kit

E02C1685-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 2a(CHMP2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Charged multivesicular body protein 2a(CHMP2A) ELISA kit

E02C1685-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 2a(CHMP2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Charged multivesicular body protein 2a(CHMP2A) ELISA kit

E02C1685-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Charged multivesicular body protein 2a(CHMP2A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human SP140(Sp140 Nuclear Body Protein) ELISA Kit