Mouse OGG1(Oxoguanine Glycosylase 1) ELISA Kit

Mouse OGG1(Oxoguanine Glycosylase 1) ELISA Kit

Mouse Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

RD-OGG1-Mu-96Tests 96 Tests
EUR 740

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

DLR-OGG1-Hu-48T 48T
EUR 517
  • Should the Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Oxoguanine Glycosylase 1 (OGG1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

DLR-OGG1-Hu-96T 96T
EUR 673
  • Should the Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Oxoguanine Glycosylase 1 (OGG1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

RDR-OGG1-Hu-48Tests 48 Tests
EUR 544

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

RDR-OGG1-Hu-96Tests 96 Tests
EUR 756

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

RD-OGG1-Hu-48Tests 48 Tests
EUR 521

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

RD-OGG1-Hu-96Tests 96 Tests
EUR 723

Mouse Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

SEC704Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Oxoguanine Glycosylase 1 (OGG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Oxoguanine Glycosylase 1 (OGG1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

SEC704Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Oxoguanine Glycosylase 1 (OGG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Oxoguanine Glycosylase 1 (OGG1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

SEC704Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Oxoguanine Glycosylase 1 (OGG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Oxoguanine Glycosylase 1 (OGG1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

SEC704Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Oxoguanine Glycosylase 1 (OGG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Oxoguanine Glycosylase 1 (OGG1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Oxoguanine Glycosylase 1 elisa. Alternative names of the recognized antigen: HMMH
  • HOGG1
  • MUTM
  • OGH1
  • 8-Oxoguanine DNA Glycosylase
  • DNA-(apurinic or apyrimidinic site) lyase
  • N-glycosylase/DNA lyase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Oxoguanine Glycosylase 1 (OGG1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Oxoguanine Glycosylase 1 (OGG1) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Oxoguanine Glycosylase 1 (OGG1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Oxoguanine Glycosylase 1 (OGG1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Oxoguanine Glycosylase 1 (OGG1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Oxoguanine Glycosylase 1 (OGG1)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O15527
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Oxoguanine Glycosylase 1 expressed in: E.coli

Recombinant Oxoguanine Glycosylase 1 (OGG1)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O08760
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 65.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Oxoguanine Glycosylase 1 expressed in: E.coli

Mouse Oxoguanine Glycosylase 1 (OGG1) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Oxoguanine Glycosylase 1 (OGG1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Oxoguanine Glycosylase 1 ELISA Kit (OGG1)

RK01987 96 Tests
EUR 521

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

SEC704Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oxoguanine Glycosylase 1 (OGG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oxoguanine Glycosylase 1 (OGG1) in tissue homogenates, cell lysates and other biological fluids.

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

SEC704Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oxoguanine Glycosylase 1 (OGG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oxoguanine Glycosylase 1 (OGG1) in tissue homogenates, cell lysates and other biological fluids.

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

SEC704Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oxoguanine Glycosylase 1 (OGG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oxoguanine Glycosylase 1 (OGG1) in tissue homogenates, cell lysates and other biological fluids.

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

SEC704Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Oxoguanine Glycosylase 1 (OGG1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<1
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Oxoguanine Glycosylase 1 (OGG1) in tissue homogenates, cell lysates and other biological fluids.

Human Oxoguanine Glycosylase 1 (OGG1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Oxoguanine Glycosylase 1 elisa. Alternative names of the recognized antigen: HMMH
  • HOGG1
  • MUTM
  • OGH1
  • 8-Oxoguanine DNA Glycosylase
  • DNA-(apurinic or apyrimidinic site) lyase
  • N-glycosylase/DNA lyase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Oxoguanine Glycosylase 1 (OGG1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse OGG1 (Oxoguanine Glycosylase 1)

ELK7138 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Oxoguanine Glycosylase 1 (OGG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ox
  • Show more
Description: A sandwich ELISA kit for detection of Oxoguanine Glycosylase 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Oxoguanine Glycosylase 1 (OGG1) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Oxoguanine Glycosylase 1 (OGG1)

Human Oxoguanine Glycosylase 1 (OGG1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human OGG1 (Oxoguanine Glycosylase 1)

ELK3235 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Oxoguanine Glycosylase 1 (OGG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ox
  • Show more
Description: A sandwich ELISA kit for detection of Oxoguanine Glycosylase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with APC.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with Biotin.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with Cy3.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with FITC.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with HRP.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with PE.

8-Oxoguanine DNA Glycosylase 1 (OGG1) Antibody

abx146022-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

8-Oxoguanine DNA Glycosylase 1 (OGG1) Antibody

abx033073-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

8-Oxoguanine DNA Glycosylase 1 (OGG1) Antibody

abx033073-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

8-Oxoguanine DNA Glycosylase 1 (OGG1) Antibody

abx235980-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

8-Oxoguanine DNA Glycosylase 1 (Ogg1) Antibody

abx431477-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

8-Oxoguanine DNA Glycosylase 1 (OGG1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

8-Oxoguanine DNA Glycosylase 1 (OGG1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

8-Oxoguanine DNA Glycosylase 1 (OGG1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Oxoguanine Glycosylase 1 (OGG1)

8-Oxoguanine Dna Glycosylase (OGG1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ELISA kit for Human OGG1 (8-Oxoguanine Glycosylase 1)

E-EL-H1939 1 plate of 96 wells
EUR 534
  • Gentaur's OGG1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human OGG1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human OGG1 (8-Oxoguanine Glycosylase 1) in samples from Serum, Plasma, Cell supernatant

Human 8-Oxoguanine DNA Glycosylase 1 (OGG1) ELISA Kit

abx351948-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

8-oxoguanine DNA glycosylase (OGG1)(Human) ELISA Kit

EUR 865

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with APC-Cy7.

8-Oxoguanine DNA Glycosylase 1 (OGG1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

8-Oxoguanine DNA Glycosylase 1 (OGG1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

8-Oxoguanine DNA Glycosylase 1 (OGG1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with APC.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with Biotin.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with Cy3.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with FITC.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with HRP.

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with PE.

OGG1 8-Oxoguanine DNA Glycosylase Mouse Recombinant Protein

PROTO08760 Regular: 5ug
EUR 317
Description: OGG1 Mouse Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 368 amino acids (1-345 a.a) and having a molecular mass of 41.3kDa. OGG1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. 

Oxoguanine Glycosylase 1 (OGG1) Polyclonal Antibody (Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OGG1 (Ser31~Gly345)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Pig Oxoguanine Glycosylase 1 (OGG1). This antibody is labeled with APC-Cy7.

OGG1 8-Oxoguanine DNA Glycosylase Human Recombinant Protein

PROTO15527 Regular: 25ug
EUR 317
Description: OGG1 Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 368 amino acids (1-345 a.a.) and having a molecular mass of 41.2 kDa. The OGG1 is fused to 23 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Mouse N-glycosylase/DNA lyase (OGG1) ELISA kit

CSB-EL016313MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse N-glycosylase/DNA lyase (OGG1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse N-glycosylase/DNA lyase (OGG1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse N-glycosylase/DNA lyase (OGG1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Ogg1/ N-glycosylase/DNA lyase ELISA Kit

E1076Mo 1 Kit
EUR 571

Mouse N- glycosylase/DNA lyase, Ogg1 ELISA KIT

ELI-04694m 96 Tests
EUR 865

Mouse N-glycosylase/DNA lyase (OGG1) ELISA Kit

abx575710-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

8-Oxoguanine DNA Glycosylase (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human N-glycosylase/DNA lyase (OGG1) ELISA Kit

abx250893-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Ogg1/ N-glycosylase/DNA lyase ELISA Kit

E0712Ra 1 Kit
EUR 571

Human OGG1/ N-glycosylase/DNA lyase ELISA Kit

E1823Hu 1 Kit
EUR 571

Human OGG1(N-glycosylase/DNA lyase) ELISA Kit

EH1601 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O15527
  • Alias: OGG1/N-glycosylase/DNA lyase/8-hydroxyguanine DNA glycosylase/8-oxoguanine DNA glycosylase/AP lyase/DNA-apurinic or apyrimidinic site lyase/HOGG1/MMH/MUTMOGH1HMMH
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human N- glycosylase/DNA lyase, OGG1 ELISA KIT

ELI-04693h 96 Tests
EUR 824

Rat N-glycosylase/DNA lyase (OGG1) ELISA Kit

abx516918-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat OGG1(N-glycosylase/DNA lyase) ELISA Kit

ER1877 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Alias: 8 oxoguanine DNA glycosylase/AP lyase/HMMH/HOGG1/MMH/MUTM/OGG1/OGH1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Recombinant Human 8-Oxoguanine DNA Glycosylase

7-03277 5µg Ask for price

Recombinant Human 8-Oxoguanine DNA Glycosylase

7-03278 20µg Ask for price

Recombinant Human 8-Oxoguanine DNA Glycosylase

7-03279 1mg Ask for price

Human N-glycosylase/DNA lyase (OGG1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human N-glycosylase/DNA lyase(OGG1) expressed in E.coli

Human N-glycosylase/DNA lyase (OGG1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human N-glycosylase/DNA lyase(OGG1) expressed in E.coli

Human N-glycosylase/DNA lyase (OGG1)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human N-glycosylase/DNA lyase(OGG1) expressed in Yeast

Recombinant Human N-Glycosylase/OGG1 (N-GST)

C128-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, 50% Glycerol, pH 7.8.

Recombinant Human N-Glycosylase/OGG1 (N-GST)

C128-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, 50% Glycerol, pH 7.8.

Recombinant Human N-Glycosylase/OGG1 (N-GST)

C128-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, 50% Glycerol, pH 7.8.

Recombinant Human N-Glycosylase/OGG1 (N-GST)

C128-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, 50% Glycerol, pH 7.8.

Ogg1/ Rat Ogg1 ELISA Kit

ELI-04692r 96 Tests
EUR 886

Human 8-Oxoguanine DNA Glycosylase (hOGG1) Control/blocking peptide #1

hOGG11-P 100 ug
EUR 164

Rabbit Anti-Human 8-Oxoguanine DNA Glycosylase (hOGG1) ab #1

hOGG11-S 100 ul
EUR 457

Mouse 8-Oxoguanine DNA Glycosylase (mOGG1) Control/blocking peptide # 3

mOGG13-P 100 ug
EUR 164

Rabbit Anti-Mouse 8-Oxoguanine DNA Glycosylase (mOGG1) antiserum #3

mOGG13-S 100 ul
EUR 457

Anti-Ogg1 Antibody

A00768-1 100ug/vial
EUR 294

Rabbit Anti-Mouse 8-Oxoguanine DNA Glycosylase (mOGG1) IgG aff pure

mOGG13-A 100 ug
EUR 482

OGG1 ELISA Kit (Mouse) (OKCD02774)

OKCD02774 96 Wells
EUR 857
Description: Description of target: DNA repair enzyme that incises DNA at 8-oxoG residues. Excises 7,8-dihydro-8-oxoguanine and 2,6-diamino-4-hydroxy-5-N-methylformamidopyrimidine (FAPY) from damaged DNA. Has a beta-lyase activity that nicks DNA 3' to the lesion. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.7 pg/mL

Rabbit Anti-Human 8-Oxoguanine DNA Glycosylase (hOGG1) IgG #1 aff pure

hOGG11-A 100 ug
EUR 482

Human OGG1 ELISA Kit

ELA-E1437h 96 Tests
EUR 824


EF005755 96 Tests
EUR 689

Rabbit Anti-Human 8-Oxoguanine DNA Glycosylase (hOGG1) protein ab #2

hOGG12-S 100 ul
EUR 457

Mouse Uracil DNA Glycosylase ELISA kit

E03U0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Uracil DNA Glycosylase ELISA kit

E03U0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Uracil DNA Glycosylase ELISA kit

E03U0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


RA25054 100 ul
EUR 422

Monoclonal Anti-Human 8-Oxoguanine DNA Glycosylase (hOGG1) protein IgG, aff pure

hOGG13-M 100 ul
EUR 482

OGG1 ELISA Kit (Human) (OKAN05120)

OKAN05120 96 Wells
EUR 792
Description: Description of target: This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL

OGG1 ELISA Kit (Rat) (OKCA02582)

OKCA02582 96 Wells
EUR 846
Description: Description of target: DNA repair enzyme that incises DNA at 8-oxoG residues. Excises 7,8-dihydro-8-oxoguanine and 2,6-diamino-4-hydroxy-5-N-methylformamidopyrimidine (FAPY) from damaged DNA. Has a beta-lyase activity that nicks DNA 3' to the lesion. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 6.25 pg/mL

OGG1 ELISA Kit (Human) (OKCD08231)

OKCD08231 96 Wells
EUR 975
Description: Description of target: Recombinant Human 8-Oxoguanine DNA Glycosylase;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

OGG1 ELISA Kit (Rat) (OKEH06169)

OKEH06169 96 Wells
EUR 766
Description: Description of target: DNA repair enzyme that incises DNA at 8-oxoG residues. Excises 7,8-dihydro-8-oxoguanine and 2,6-diamino-4-hydroxy-5-N-methylformamidopyrimidine (FAPY) from damaged DNA. Has a beta-lyase activity that nicks DNA 3' to the lesion. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Mouse Uracil- DNA glycosylase, Ung ELISA KIT

ELI-51731m 96 Tests
EUR 865

Mouse Thymine DNA Glycosylase (TDG) ELISA Kit

abx390736-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Mouse OGG1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OGG1 Recombinant Protein (Mouse)

RP155840 100 ug Ask for price

Anti-Ogg1 (mouse) antibody

STJ71223 100 µg
EUR 359

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Mouse Nudt1/ 7,8-dihydro-8-oxoguanine triphosphatase ELISA Kit

E1068Mo 1 Kit
EUR 632

Nudt1 ELISA Kit| Mouse 7,8-dihydro-8-oxoguanine triphosphatase

EF015737 96 Tests
EUR 689

Mouse 7,8-Dihydro-8-Oxoguanine Triphosphatase (NUDT1) ELISA Kit

abx520234-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

OGG1 antibody

70R-19032 50 ul
EUR 435
Description: Rabbit polyclonal OGG1 antibody

OGG1 antibody

70R-10273 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal OGG1 antibody

OGG1 antibody

70R-10274 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal OGG1 antibody

OGG1 antibody

38236-100ul 100ul
EUR 252

OGG1 Antibody

49583-100ul 100ul
EUR 333

OGG1 Antibody

49583-50ul 50ul
EUR 239

OGG1 Antibody

DF6401 200ul
EUR 304
Description: OGG1 Antibody detects endogenous levels of total OGG1.

OGG1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against OGG1. Recognizes OGG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

OGG1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OGG1. Recognizes OGG1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OGG1 Antibody

ABD6401 100 ug
EUR 438


YF-PA13530 50 ug
EUR 363
Description: Mouse polyclonal to OGG1


YF-PA13531 100 ul
EUR 403
Description: Rabbit polyclonal to OGG1


YF-PA13532 100 ug
EUR 403
Description: Rabbit polyclonal to OGG1

Ogg1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4847302 1.0 ug DNA
EUR 154

Mouse N-Methylpurine DNA Glycosylase (MPG) ELISA Kit

abx390063-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse DNA- 3- methyladenine glycosylase, Mpg ELISA KIT

ELI-49804m 96 Tests
EUR 865

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Mpg ELISA Kit| Mouse DNA-3-methyladenine glycosylase ELISA Kit

EF015702 96 Tests
EUR 689

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Ogg1 ORF Vector (Mouse) (pORF)

ORF051948 1.0 ug DNA
EUR 506

Rat Uracil DNA Glycosylase ELISA kit

E02U0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Uracil DNA Glycosylase ELISA kit

E02U0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Uracil DNA Glycosylase ELISA kit

E02U0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Uracil DNA Glycosylase ELISA kit

E04U0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Uracil DNA Glycosylase ELISA kit

E04U0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Uracil DNA Glycosylase ELISA kit

E04U0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Uracil DNA Glycosylase ELISA kit

E01U0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Uracil DNA Glycosylase ELISA kit

E01U0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Uracil DNA Glycosylase ELISA kit

E01U0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Uracil DNA Glycosylase ELISA kit

E07U0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Uracil DNA Glycosylase ELISA kit

E07U0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Uracil DNA Glycosylase ELISA kit

E07U0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Uracil DNA Glycosylase ELISA kit

E08U0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Uracil DNA Glycosylase ELISA kit

E08U0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Uracil DNA Glycosylase ELISA kit

E08U0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Uracil DNA Glycosylase ELISA kit

E09U0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Uracil DNA Glycosylase ELISA kit

E09U0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Uracil DNA Glycosylase ELISA kit

E09U0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Uracil DNA Glycosylase ELISA kit

E06U0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Uracil DNA Glycosylase ELISA kit

E06U0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Uracil DNA Glycosylase ELISA kit

E06U0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

OGG1 ELISA Kit (Human) : 96 Wells (OKEH01015)

OKEH01015 96 Wells
EUR 662
Description: Description of target: This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008];Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Human 8-oxoguanine DNA glycosydase(hOGG1)ELISA kit

CSB-E12686h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human 8-oxoguanine DNA glycosydase (hOGG1) in samples from serum, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human 8-oxoguanine DNA glycosydase(hOGG1)ELISA kit

  • EUR 946.00
  • EUR 5782.00
  • EUR 3060.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human 8-oxoguanine DNA glycosydase(hOGG1) in samples from serum, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Nth Like DNA Glycosylase 1 (NTHL1) ELISA Kit

abx381901-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Mouse DNA-3-methyladenine glycosylase (MPG)

KTE70981-48T 48T
EUR 332
  • MPG (N-Methylpurine DNA Glycosylase) is a Protein Coding gene. Among its related pathways are Recognition and association of DNA glycosylase with site containing an affected purine and Telomere C-strand (Lagging Strand) Synthesis. GO annotations rela
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse DNA-3-methyladenine glycosylase (MPG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse DNA-3-methyladenine glycosylase (MPG)

KTE70981-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MPG (N-Methylpurine DNA Glycosylase) is a Protein Coding gene. Among its related pathways are Recognition and association of DNA glycosylase with site containing an affected purine and Telomere C-strand (Lagging Strand) Synthesis. GO annotations rela
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse DNA-3-methyladenine glycosylase (MPG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse DNA-3-methyladenine glycosylase (MPG)

KTE70981-96T 96T
EUR 539
  • MPG (N-Methylpurine DNA Glycosylase) is a Protein Coding gene. Among its related pathways are Recognition and association of DNA glycosylase with site containing an affected purine and Telomere C-strand (Lagging Strand) Synthesis. GO annotations rela
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse DNA-3-methyladenine glycosylase (MPG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

OGG1 Rabbit pAb

A1384-100ul 100 ul
EUR 308

OGG1 Rabbit pAb

A1384-200ul 200 ul
EUR 459

OGG1 Rabbit pAb

A1384-20ul 20 ul
EUR 183

OGG1 Rabbit pAb

A1384-50ul 50 ul
EUR 223

OGG1 Blocking Peptide

33R-2136 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OGG1 antibody, catalog no. 70R-10273

OGG1 Blocking Peptide

33R-1611 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OGG1 antibody, catalog no. 70R-10274

OGG1 inhibitor O8

EUR 588

OGG1 inhibitor O8

EUR 185

OGG1 Blocking Peptide

DF6401-BP 1mg
EUR 195

OGG1 Polyclonal Antibody

A-6703 100 µl
EUR 483.55
Description: reagents widely cited

OGG1 Conjugated Antibody

C49583 100ul
EUR 397

OGG1 Conjugated Antibody

C38236 100ul
EUR 397

OGG1 cloning plasmid

CSB-CL016313HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1038
  • Sequence: atgcctgcccgcgcgcttctgcccaggcgcatggggcatcgtactctagcctccactcctgccctgtgggcctccatcccgtgccctcgctctgagctgcgcctggacctggttctgccttctggacaatctttccggtggagggagcaaagtcctgcacactggagtggtgtac
  • Show more
Description: A cloning plasmid for the OGG1 gene.

OGG1 Polyclonal Antibody

A60122 100 µg
EUR 570.55
Description: Ask the seller for details

OGG1 Rabbit pAb

A2268-100ul 100 ul
EUR 308

OGG1 Rabbit pAb

A2268-200ul 200 ul
EUR 459

OGG1 Rabbit pAb

A2268-20ul 20 ul Ask for price

OGG1 Rabbit pAb

A2268-50ul 50 ul Ask for price

OGG1 Polyclonal Antibody

ABP59640-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human OGG1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of OGG1 from Human. This OGG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OGG1 protein

OGG1 Polyclonal Antibody

ABP59640-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human OGG1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of OGG1 from Human. This OGG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OGG1 protein

OGG1 Polyclonal Antibody

ABP59640-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human OGG1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of OGG1 from Human. This OGG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OGG1 protein

anti- OGG1 antibody

FNab05980 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: 8-oxoguanine DNA glycosylase
  • Uniprot ID: O15527
  • Gene ID: 4968
  • Research Area: Metabolism
Description: Antibody raised against OGG1

OGG1 Polyclonal Antibody

ES11984-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against OGG1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

OGG1 Polyclonal Antibody

ES11984-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against OGG1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-OGG1 antibody

PAab05980 100 ug
EUR 355

Anti-OGG1 antibody

STJ24860 100 µl
EUR 277
Description: This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined.

Anti-OGG1 antibody

STJ24861 100 µl
EUR 277
Description: This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined.

Anti-OGG1 antibody

STJ193142 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to OGG1

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Thymine DNA Glycosylase (TDG) ELISA Kit

DLR-TDG-Hu-48T 48T
EUR 517
  • Should the Human Thymine DNA Glycosylase (TDG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thymine DNA Glycosylase (TDG) in samples from tissue homogenates or other biological fluids.

Human Thymine DNA Glycosylase (TDG) ELISA Kit

DLR-TDG-Hu-96T 96T
EUR 673
  • Should the Human Thymine DNA Glycosylase (TDG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thymine DNA Glycosylase (TDG) in samples from tissue homogenates or other biological fluids.

Human Uracil DNA Glycosylase (UNG) ELISA Kit

DLR-UNG-Hu-48T 48T
EUR 517
  • Should the Human Uracil DNA Glycosylase (UNG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uracil DNA Glycosylase (UNG) in samples from tissue homogenates or other biological fluids.

Human Uracil DNA Glycosylase (UNG) ELISA Kit

DLR-UNG-Hu-96T 96T
EUR 673
  • Should the Human Uracil DNA Glycosylase (UNG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uracil DNA Glycosylase (UNG) in samples from tissue homogenates or other biological fluids.

Guinea pig Uracil DNA Glycosylase ELISA kit

E05U0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Uracil DNA Glycosylase ELISA kit

E05U0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Uracil DNA Glycosylase ELISA kit

E05U0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Uracil DNA Glycosylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Uracil DNA Glycosylase (UNG) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Thymine DNA Glycosylase (TDG) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Uracil- DNA glycosylase, UNG ELISA KIT

ELI-28577h 96 Tests
EUR 824

Rat Thymine DNA Glycosylase (TDG) ELISA Kit

QY-E11861 96T
EUR 374

Human Uracil DNA Glycosylase (UNG) ELISA Kit

RDR-UNG-Hu-48Tests 48 Tests
EUR 544

Human Uracil DNA Glycosylase (UNG) ELISA Kit

RDR-UNG-Hu-96Tests 96 Tests
EUR 756

Mouse OGG1(Oxoguanine Glycosylase 1) ELISA Kit