Rat TKT(Transketolase) ELISA Kit

Rat TKT(Transketolase) ELISA Kit

Rat Transketolase (TKT) ELISA Kit
RDR-TKT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Transketolase (TKT) ELISA Kit
RDR-TKT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Rat Transketolase (TKT) ELISA Kit
RD-TKT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Transketolase (TKT) ELISA Kit
RD-TKT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Transketolase (TKT) ELISA Kit
DLR-TKT-Hu-48T	DL Develop	48T	EUR 517
Should the Human Transketolase (TKT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase (TKT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Transketolase (TKT) ELISA Kit
DLR-TKT-Hu-96T	DL Develop	96T	EUR 673
Should the Human Transketolase (TKT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase (TKT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Transketolase (TKT) ELISA Kit
RDR-TKT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Transketolase (TKT) ELISA Kit
RDR-TKT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Transketolase (TKT) ELISA Kit
RD-TKT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Transketolase (TKT) ELISA Kit
RD-TKT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Transketolase (TKT) ELISA Kit
abx573626-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Transketolase, TKT ELISA Kit
ELA-E0113r	Lifescience Market	96 Tests	EUR 678

Rat Transketolase (TKT) ELISA Kit
20-abx156184	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Transketolase (TKT) ELISA Kit
SEH019Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit
SEH019Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit
SEH019Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit
SEH019Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit
4-SEH019Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transketolase elisa. Alternative names of the recognized antigen: TK Wernicke-Korsakoff Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Transketolase (TKT) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat TKT (Transketolase)
ELK7034	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase (TKT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transketolase Show more
Description: A sandwich ELISA kit for detection of Transketolase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Transketolase (TKT) CLIA Kit
20-abx495354	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Transketolase (TKT) Protein
20-abx167617	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cow Transketolase (TKT) ELISA Kit
abx511828-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Transketolase (TKT) ELISA Kit
abx511830-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Transketolase (TKT) ELISA Kit
abx570798-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Bovine Transketolase, TKT ELISA Kit
ELA-E0113b	Lifescience Market	96 Tests	EUR 928

Mouse Transketolase, TKT ELISA Kit
ELA-E0113m	Lifescience Market	96 Tests	EUR 678

Mouse Tkt/ Transketolase ELISA Kit
E1477Mo	Sunlong	1 Kit	EUR 571

Human TKT/ Transketolase ELISA Kit
E2507Hu	Sunlong	1 Kit	EUR 571

Human Transketolase (TKT) ELISA Kit
20-abx153380	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Transketolase ELISA Kit (TKT)
RK02393	Abclonal	96 Tests	EUR 521

Human Transketolase (TKT) ELISA Kit
SEH019Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit
SEH019Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit
SEH019Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit
SEH019Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit
4-SEH019Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transketolase elisa. Alternative names of the recognized antigen: TK Wernicke-Korsakoff Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transketolase (TKT) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Transketolase (TKT) Antibody
20-abx116203	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Transketolase (TKT) Antibody
20-abx129192	Abbexa	EUR 314.00 EUR 133.00 EUR 815.00 EUR 425.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transketolase (TKT) Antibody
20-abx130403	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transketolase (TKT) Antibody
abx122017-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Transketolase (TKT) Antibody
20-abx142264	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Transketolase (TKT) Antibody
20-abx004826	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Transketolase (TKT) Antibody
20-abx174907	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Transketolase (TKT) Antibody
20-abx174908	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Transketolase (TKT) Antibody
abx238938-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Transketolase (TKT) Antibody
abx238939-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Transketolase (TKT) Antibody
20-abx241314	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Transketolase (TKT) Antibody
20-abx241315	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human Transketolase (TKT)
1-CSB-EP023580HUe1	Cusabio	EUR 621.00 EUR 381.00 EUR 1943.00 EUR 882.00 EUR 1335.00 EUR 451.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 67.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transketolase(TKT) expressed in E.coli

Recombinant Transketolase (TKT)
4-RPH019Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P29401 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Transketolase expressed in: E.coli

Recombinant Transketolase (TKT)
4-RPH019Ra01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P50137 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.9kDa Isoelectric Point: 7.1
Description: Recombinant Rat Transketolase expressed in: E.coli

ELISA kit for Human TKT (Transketolase)
ELK3271	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase (TKT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transketolase Show more
Description: A sandwich ELISA kit for detection of Transketolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)
KTE70217-48T	Abbkine	48T	EUR 332
Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)
KTE70217-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)
KTE70217-96T	Abbkine	96T	EUR 539
Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Transketolase (TKT) CLIA Kit
20-abx495353	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Transketolase (TKT) Protein
20-abx166627	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transketolase (TKT) Polyclonal Antibody (Human, Rat)
4-PAH019Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT)

TKT Transketolase Human Recombinant Protein
PROTP29401	BosterBio	Regular: 10ug	EUR 317
Description: TKT Human Recombinant produced in E. coli is a single polypeptide chain containing 643 amino acids (1-623) and having a molecular mass of 70.0kDa.;TKT is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Transketolase (TKT) Polyclonal Antibody (Human)
4-PAH019Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT)

Transketolase (TKT) Polyclonal Antibody (Human, Rat), APC
4-PAH019Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with APC.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAH019Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with Biotin.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), Cy3
4-PAH019Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with Cy3.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), FITC
4-PAH019Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with FITC.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), HRP
4-PAH019Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with HRP.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), PE
4-PAH019Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with PE.

Transketolase (TKT) Polyclonal Antibody (Human), APC
4-PAH019Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with APC.

Transketolase (TKT) Polyclonal Antibody (Human), Biotinylated
4-PAH019Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with Biotin.

Transketolase (TKT) Polyclonal Antibody (Human), Cy3
4-PAH019Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with Cy3.

Transketolase (TKT) Polyclonal Antibody (Human), FITC
4-PAH019Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with FITC.

Transketolase (TKT) Polyclonal Antibody (Human), HRP
4-PAH019Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with HRP.

Transketolase (TKT) Polyclonal Antibody (Human), PE
4-PAH019Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with PE.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAH019Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with APC-Cy7.

Transketolase (TKT) Polyclonal Antibody (Human), APC-Cy7
4-PAH019Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with APC-Cy7.

Rat Transketolase ELISA kit
E02T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transketolase ELISA kit
E02T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transketolase ELISA kit
E02T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TKT ELISA Kit (Rat) (OKCD00704)
OKCD00704	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

Mouse Transketolase ELISA kit
E03T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transketolase ELISA kit
E03T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transketolase ELISA kit
E03T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit
E01T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit
E01T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit
E01T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit
E04T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit
E04T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit
E04T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA Kit
ELA-E0113h	Lifescience Market	96 Tests	EUR 824

Dog Transketolase ELISA kit
E08T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transketolase ELISA kit
E08T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transketolase ELISA kit
E08T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit
E07T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit
E07T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit
E07T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit
E06T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit
E06T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit
E06T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit
E09T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit
E09T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit
E09T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Transketolase ELISA KIT|Human
EF003792	Lifescience Market	96 Tests	EUR 689

Guinea pig Transketolase ELISA kit
E05T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transketolase ELISA kit
E05T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transketolase ELISA kit
E05T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TKT ELISA Kit (Human) (OKAN05459)
OKAN05459	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.071 ng/mL

TKT ELISA Kit (Human) (OKCD09022)
OKCD09022	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: TKT belongs to the transketolase family. TKT has been implicated in the latent genetic disease Wernicke-Korsakoff syndrome (WKS), which causes specific brain damage.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.071ng/mL

TKT ELISA Kit (Human) (OKEH03030)
OKEH03030	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

TKT ELISA Kit (Mouse) (OKEH05920)
OKEH05920	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

TKT ELISA Kit (Bovine) (OKEH07303)
OKEH07303	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Rat TKT shRNA Plasmid
20-abx986273	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TKT Recombinant Protein (Rat)
RP233213	ABM	100 ug	Ask for price

anti-Transketolase
YF-PA15046	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Transketolase

anti-Transketolase
YF-PA15047	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to Transketolase

anti-Transketolase
YF-PA15048	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Transketolase

TKT siRNA
20-abx905591	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TKT siRNA
20-abx936854	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TKT siRNA
20-abx936855	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TKT antibody
70R-20843	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TKT antibody

TKT antibody
70R-2587	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TKT antibody

TKT antibody
38817-100ul	SAB	100ul	EUR 252

TKT Antibody
42786-100ul	SAB	100ul	EUR 252

TKT antibody
10R-6070	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal TKT antibody

TKT Antibody
1-CSB-PA570820	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TKT Antibody
1-CSB-PA023580GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TKT Antibody
1-CSB-PA025245	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Tkt ORF Vector (Rat) (pORF)
ORF077739	ABM	1.0 ug DNA	EUR 506

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

anti- Transketolase antibody
FNab08938	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: transketolase Uniprot ID: P29401 Gene ID: 7086 Research Area: Metabolism
Description: Antibody raised against Transketolase

anti- Transketolase antibody
FNab08939	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 IF: 1:20-1:200 Immunogen: transketolase Uniprot ID: P29401 Gene ID: 7086 Research Area: Metabolism
Description: Antibody raised against Transketolase

Recombinant mouse Transketolase
P1406	FN Test	100ug	Ask for price
Uniprot ID: P40142 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse Transketolase

Anti-Transketolase antibody
PAab08938	Lifescience Market	100 ug	EUR 386

TKT Conjugated Antibody
C38817	SAB	100ul	EUR 397

TKT cloning plasmid
CSB-CL023580HU1-10ug	Cusabio	10ug	EUR 633
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1872 Sequence: atggagagctaccacaagcctgaccagcagaagctgcaggccttgaaggacacggccaaccgcctacgtatcagctccatccaggccaccactgcggcgggctctggccaccccacgtcatgctgcagcgccgcagagatcatggctgtcctctttttccacaccatgcgctaca Show more
Description: A cloning plasmid for the TKT gene.

TKT cloning plasmid
CSB-CL023580HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1374 Sequence: atggccttcgccagcatctataagctggacaaccttgtggccattctagacatcaatcgcctgggccagagtgacccggccccgctgcagcaccagatggacatctaccagaagcggtgcgaggccttcggttggcatgccatcatcgtggatggacacagcgtggaggagctgt Show more
Description: A cloning plasmid for the TKT gene.

TKT Polyclonal Antibody
ES11750-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TKT. This antibody is tested and validated for WB, ELISA, WB, ELISA

TKT Polyclonal Antibody
ES11750-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TKT. This antibody is tested and validated for WB, ELISA, WB, ELISA

TKT Enzyme (Recombinant)
20-abx073794	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

TKT Polyclonal Antibody
ABP60697-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human TKT protein Applications tips:
Description: A polyclonal antibody for detection of TKT from Human. This TKT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TKT protein

TKT Polyclonal Antibody
ABP60697-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human TKT protein Applications tips:
Description: A polyclonal antibody for detection of TKT from Human. This TKT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TKT protein

TKT Polyclonal Antibody
ABP60697-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human TKT protein Applications tips:
Description: A polyclonal antibody for detection of TKT from Human. This TKT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TKT protein

TKT Rabbit pAb
A6314-100ul	Abclonal	100 ul	EUR 308

TKT Rabbit pAb
A6314-200ul	Abclonal	200 ul	EUR 459

TKT Rabbit pAb
A6314-20ul	Abclonal	20 ul	EUR 183

TKT Rabbit pAb
A6314-50ul	Abclonal	50 ul	EUR 223

TKT Rabbit pAb
A13553-100ul	Abclonal	100 ul	EUR 308

TKT Rabbit pAb
A13553-200ul	Abclonal	200 ul	EUR 459

TKT Rabbit pAb
A13553-20ul	Abclonal	20 ul	EUR 183

TKT Rabbit pAb
A13553-50ul	Abclonal	50 ul	EUR 223

TKT Blocking Peptide
33R-2753	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TKT antibody, catalog no. 70R-2587

Anti-TKT antibody
STJ28236	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-TKT antibody
STJ115514	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-TKT antibody
STJ192908	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TKT

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Tktl2 ELISA Kit| Mouse Transketolase-like protein 2 ELISA Kit
EF016417	Lifescience Market	96 Tests	EUR 689

TKTL2 ELISA Kit| Bovine Transketolase-like protein 2 ELISA Kit
EF011986	Lifescience Market	96 Tests	EUR 689

Tkt sgRNA CRISPR Lentivector set (Rat)
K7088301	ABM	3 x 1.0 ug	EUR 339

Human Transketolase- like protein 1, TKTL1 ELISA KIT
ELI-16212h	Lifescience Market	96 Tests	EUR 824

Bovine Transketolase- like protein 2, TKTL2 ELISA KIT
ELI-16213b	Lifescience Market	96 Tests	EUR 928

Mouse Transketolase- like protein 2, Tktl2 ELISA KIT
ELI-52128m	Lifescience Market	96 Tests	EUR 865

Bovine Transketolase- like protein 1, TKTL1 ELISA KIT
ELI-28947b	Lifescience Market	96 Tests	EUR 928

Mouse Transketolase- like protein 1, Tktl1 ELISA KIT
ELI-41846m	Lifescience Market	96 Tests	EUR 865

Human Transketolase- like protein 2, TKTL2 ELISA KIT
ELI-41847h	Lifescience Market	96 Tests	EUR 824

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
20-abx153312	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Transketolase-like protein 2 (TKTL2) ELISA Kit
abx385487-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Transketolase-like protein 2 (TKTL2) ELISA Kit
abx390774-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
DLR-TKTL1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
DLR-TKTL1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
RDR-TKTL1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
RDR-TKTL1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
RD-TKTL1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
RD-TKTL1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
SEH018Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
SEH018Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
SEH018Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
SEH018Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
4-SEH018Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transketolase Like Protein 1 elisa. Alternative names of the recognized antigen: TKR TKT2 TK 2 Transketolase-related protein Transketolase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Human TKT shRNA Plasmid
20-abx954853	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TKT protein (His tag)
80R-2190	Fitzgerald	50 ug	EUR 424
Description: Purified recombinant Human TKT Protein (His tag)

Mouse TKT shRNA Plasmid
20-abx973127	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TKT Recombinant Protein (Human)
RP031648	ABM	100 ug	Ask for price

TKT Recombinant Protein (Human)
RP031651	ABM	100 ug	Ask for price

TKT Recombinant Protein (Mouse)
RP178889	ABM	100 ug	Ask for price

ELISA kit for Human TKTL1 (Transketolase Like Protein 1)
ELK4675	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase Like Protein 1 (TKTL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Transketolase Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Transketolase-like protein 1 (TKTL1)
KTE70216-48T	Abbkine	48T	EUR 332
Transketolase (TKT ) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. As part of a systematic search for differentially expressed genes, Coy et al. (1996) isolated a novel transketolase-related gene Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase-like protein 1 (TKTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transketolase-like protein 1 (TKTL1)
KTE70216-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Transketolase (TKT ) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. As part of a systematic search for differentially expressed genes, Coy et al. (1996) isolated a novel transketolase-related gene Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase-like protein 1 (TKTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transketolase-like protein 1 (TKTL1)
KTE70216-96T	Abbkine	96T	EUR 539
Transketolase (TKT ) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. As part of a systematic search for differentially expressed genes, Coy et al. (1996) isolated a novel transketolase-related gene Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase-like protein 1 (TKTL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Tkt sgRNA CRISPR Lentivector (Rat) (Target 1)
K7088302	ABM	1.0 ug DNA	EUR 154

Tkt sgRNA CRISPR Lentivector (Rat) (Target 2)
K7088303	ABM	1.0 ug DNA	EUR 154

Tkt sgRNA CRISPR Lentivector (Rat) (Target 3)
K7088304	ABM	1.0 ug DNA	EUR 154

TKT Protein Vector (Rat) (pPB-C-His)
PV310954	ABM	500 ng	EUR 603

TKT Protein Vector (Rat) (pPB-N-His)
PV310955	ABM	500 ng	EUR 603

TKT Protein Vector (Rat) (pPM-C-HA)
PV310956	ABM	500 ng	EUR 603

TKT Protein Vector (Rat) (pPM-C-His)
PV310957	ABM	500 ng	EUR 603

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Escherichia coli Transketolase 1 (tktA)
1-CSB-EP340865ENV	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 88.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Transketolase 1(tktA) expressed in E.coli

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

TKT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV677377	ABM	1.0 ug DNA	EUR 682

TKT Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV677381	ABM	1.0 ug DNA	EUR 682

TKT Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV677382	ABM	1.0 ug DNA	EUR 682

Tkt ORF Vector (Mouse) (pORF)
ORF059631	ABM	1.0 ug DNA	EUR 506

Rat TKT(Transketolase) ELISA Kit