Human DEXI(Dexamethasone Induced Protein) ELISA Kit

Human DEXI(Dexamethasone Induced Protein) ELISA Kit

Human Dexamethasone Induced Protein (DEXI) ELISA Kit
RD-DEXI-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Dexamethasone Induced Protein (DEXI) ELISA Kit
RD-DEXI-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Dexamethasone Induced Protein (DEXI) ELISA Kit
abx571639-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human DEXI/ Dexamethasone-induced protein ELISA Kit
E0685Hu	Sunlong	1 Kit	EUR 571

Human DEXI(Dexamethasone-induced protein) ELISA Kit
EH1851	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: O95424 Alias: DEXI/MYLE(Dexamethasone-induced protein)/Protein MYLE
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Dexamethasone- induced protein, DEXI ELISA KIT
ELI-05290h	Lifescience Market	96 Tests	EUR 824

Human Dexamethasone Induced Protein (DEXI) ELISA Kit
20-abx151306	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit
abx251164-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit
SEQ374Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit
SEQ374Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit
SEQ374Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit
SEQ374Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dexamethasone Induced Protein (DEXI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dexamethasone Induced Protein (DEXI) in tissue homogenates, cell lysates and other biological fluids.

Human Dexamethasone Induced Protein (DEXI) ELISA Kit
4-SEQ374Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Dexamethasone Induced Protein elisa. Alternative names of the recognized antigen: MYLE Dexamethasone Induced Transcript
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dexamethasone Induced Protein (DEXI) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Dexamethasone Induced Protein (DEXI) Antibody
20-abx172104	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Dexamethasone Induced Protein (DEXI) Antibody
20-abx176156	Abbexa	EUR 1316.00 EUR 620.00	1 mg 200 ug
Please enquire.

Dexamethasone Induced Protein (DEXI) Antibody
20-abx301375	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dexamethasone Induced Protein (DEXI) Antibody
abx232346-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Human Dexamethasone Induced Protein (DEXI) Protein
20-abx653170	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Dexamethasone Induced Protein (DEXI) ELISA Kit
abx517951-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Dexamethasone- induced protein, Dexi ELISA KIT
ELI-05291m	Lifescience Market	96 Tests	EUR 865

Human Dexamethasone Induced Protein (DEXI) CLIA Kit
20-abx496188	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human DEXI (Dexamethasone Induced Protein)
ELK6999	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dexamethasone Induced Protein (DEXI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Dexamethasone Induced Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Dexamethasone Induced Protein (DEXI) Antibody (HRP)
20-abx306688	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dexamethasone Induced Protein (DEXI) Antibody (FITC)
20-abx306689	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dexamethasone Induced Protein (DEXI) Antibody (Biotin)
20-abx306690	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human RAS, Dexamethasone-Induced 1 (RASD1) ELISA Kit
abx251098-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human RASD1/ Dexamethasone-induced Ras-related protein 1 ELISA Kit
E2129Hu	Sunlong	1 Kit	EUR 571

Human RASD1(Dexamethasone-induced Ras-related protein 1) ELISA Kit
EH1790	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q9Y272 Alias: RASD1/Dexamethasone-induced Ras-related protein 1/Activator of G-protein signaling 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit
RD-RASD1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit
RD-RASD1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit
RDR-RASD1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Dexamethasone-Induced Ras-Related Protein 1 (RASD1) ELISA Kit
RDR-RASD1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse RAS, Dexamethasone-Induced 1 (RASD1) ELISA Kit
abx517697-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat RAS, Dexamethasone-Induced 1 (RASD1) ELISA Kit
abx517698-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

RAS, Dexamethasone-Induced 1 (RASD1) Antibody
abx027211-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

RAS, Dexamethasone-Induced 1 (RASD1) Antibody
abx027211-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Human DEXI ELISA Kit
ELA-E1618h	Lifescience Market	96 Tests	EUR 824

DEXI ELISA KIT|Human
EF005975	Lifescience Market	96 Tests	EUR 689

DEXI ELISA Kit (Human) (OKCD09458)
OKCD09458	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

DEXI ELISA Kit (Human) (OKEH04268)
OKEH04268	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL

Dexamethasone (DEX) ELISA Kit
abx364822-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Dexamethasone
AG023	Unibiotest	1 mg	EUR 523

Dexamethasone
CA057-001	GenDepot	1g	EUR 196

Dexamethasone
AT023	Unibiotest	1mg	EUR 1790

Dexamethasone
E1KS1322	EnoGene	100mg	EUR 247

Dexamethasone
HY-14648	MedChemExpress	10mM/1mL	EUR 113

Dexamethasone
GP8543-1G	Glentham Life Sciences	1 g	EUR 90

Dexamethasone
GP8543-250MG	Glentham Life Sciences	250 mg	EUR 54

Dexamethasone
GP8543-5G	Glentham Life Sciences	5 g	EUR 166

Dexamethasone
20-abx076546	Abbexa	EUR 244.00 EUR 509.00	1 g 5 g
Shipped within 5-12 working days.

Dexamethasone
20-abx082283	Abbexa	EUR 217.00 EUR 384.00	100 mg 1 g
Shipped within 5-10 working days.

Dexamethasone
abx183974-5g	Abbexa	5 g	EUR 370
Shipped within 1-2 weeks.

Dexamethasone
1042-10G	Biovision		EUR 659

Dexamethasone
1042-1G	Biovision		EUR 191

DEXI Recombinant Protein (Human)
RP009178	ABM	100 ug	Ask for price

PoFAine Dexamethasone,Dex ELISA Kit
CN-01281P1	ChemNorm	96T	EUR 439

PoFAine Dexamethasone,Dex ELISA Kit
CN-01281P2	ChemNorm	48T	EUR 290

Porcine dexamethasone (Dex) ELISA Kit
QY-E40062	Qayee Biotechnology	96T	EUR 400

DEXI ELISA Kit (Mouse) (OKEH05391)
OKEH05391	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.316 ng/mL

Dexamethasone acetate
B1926-100	ApexBio	100 mg	EUR 166
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.

Dexamethasone acetate
B1926-5	ApexBio	5 mg	EUR 108
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.

Dexamethasone acetate
B1926-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 142
Description: Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs that has anti-inflammatory and immunosuppressant properties.

Dexamethasone palmitate
HY-128922	MedChemExpress	50mg	EUR 245

Dexamethasone (acetate)
HY-14648A	MedChemExpress	5g	EUR 199

Dexamethasone-HRP
80-1142	Fitzgerald	500 ul	EUR 417
Description: Dexamethasone 21 Conjugate for use in immunoassays

Dexamethasone (DHAP)
A2324-100	ApexBio	100 mg	EUR 166
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)
A2324-1000	ApexBio	1 g	EUR 139
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)
A2324-5	ApexBio	5 mg	EUR 108
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)
A2324-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 154
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

Dexamethasone (DHAP)
A2324-5000	ApexBio	5 g	EUR 293
Description: Glucocorticoid; anti-inflammatory. Reduces levels of activated NF-?B in immature dendritic cells (DCs) and inhibits differentiation into mature DCs. Induces differentiation of human mesenchymal stem cells (MSCs). Also induces autophagy in acute lymphoblas

DEXI siRNA
20-abx914034	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DEXI siRNA
20-abx914035	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DEXI Antibody
1-CSB-PA529744LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DEXI. Recognizes DEXI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

pOTB7-DEXI
PVT18336	Lifescience Market	2 ug	EUR 231

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

DEXI Recombinant Protein (Rat)
RP197906	ABM	100 ug	Ask for price

DEXI Recombinant Protein (Mouse)
RP128819	ABM	100 ug	Ask for price

Human DEXI shRNA Plasmid
20-abx959124	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Dexamethasone Sodium Phosphate
B1588-100	ApexBio	100 mg	EUR 166
Description: Dexamethasone is an interleukin receptor inhibitor and also suppresses COX-2.

Dexamethasone Sodium Phosphate
B1588-5	ApexBio	5 mg	EUR 108
Description: Dexamethasone is an interleukin receptor inhibitor and also suppresses COX-2.

Dexamethasone phosphate disodium
HY-B1829A	MedChemExpress	10mM/1mL	EUR 113

Dexamethasone 9,11-epoxide
HY-N0348	MedChemExpress	10mM/1mL	EUR 126

Dexamethasone phosphate sodium
20-abx183975	Abbexa	EUR 342.00 EUR 648.00	1 g 5 g
Shipped within 1-2 weeks.

Dexamethasone Hemisuccinate Antibody
abx411076-1ml	Abbexa	1 ml	EUR 439
Shipped within 1 week.

Dexamethasone (10 mM)
1042-1	Biovision		EUR 153

Dexamethasone 21 antibody
20-1436	Fitzgerald	100 ul	EUR 657
Description: Sheep polyclonal Dexamethasone 21 antibody

Dexamethasone(21) [HRP]
DAG1086	Creative Diagnostics	0.5ml	EUR 714

Dexamethasone phosphate disodium
B2744-1G	Biovision	1 g	EUR 115

Dexamethasone phosphate disodium
B2744-5G	Biovision	5 g	EUR 277

DEXI cloning plasmid
CSB-CL529744HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 288 Sequence: atgctcggcgcccgggtcgcggcccacctggacgcactgggccccctggtcccctacgtgccgccgccgctgctgccctctatgttctacgtgggcctgttcttcgtcaatgtgctgatcctgtactacgccttcctcatggagtacatcgtcctcaacgtgggcctcgtcttcct Show more
Description: A cloning plasmid for the DEXI gene.

anti- DEXI antibody
FNab02346	FN Test	100µg	EUR 548.75
Immunogen: dexamethasone-induced transcript Uniprot ID: O95424 Gene ID: 28955 Research Area: Signal Transduction
Description: Antibody raised against DEXI

DEXI Polyclonal Antibody
A58766	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

DEXI Rabbit pAb
A14879-100ul	Abclonal	100 ul	EUR 308

DEXI Rabbit pAb
A14879-200ul	Abclonal	200 ul	EUR 459

DEXI Rabbit pAb
A14879-20ul	Abclonal	20 ul	EUR 183

DEXI Rabbit pAb
A14879-50ul	Abclonal	50 ul	EUR 223

DEXI Polyclonal Antibody
28740-100ul	SAB	100ul	EUR 252

DEXI Polyclonal Antibody
28740-50ul	SAB	50ul	EUR 187

Anti-DEXI antibody
PAab02346	Lifescience Market	100 ug	EUR 386

pSV40- Dexi- m
PVT11649	Lifescience Market	2 ug	EUR 273

Anti-DEXI antibody
STJ117079	St John's Laboratory	100 µl	EUR 277

Human Androgen Induced Protein 1 ELISA kit
E01A0494-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Androgen Induced Protein 1 ELISA kit
E01A0494-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Androgen Induced Protein 1 ELISA kit
E01A0494-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Androgen Induced Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Estrogen-induced protein pS2 ELISA Kit
GA-E0437HM-48T	GenAsia Biotech	48T	EUR 289

Human Estrogen-induced protein pS2 ELISA Kit
GA-E0437HM-96T	GenAsia Biotech	96T	EUR 466

Human Prolactin Induced Protein (PIP) ELISA Kit
20-abx152748	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Estrogen-induced protein pS2 ELISA Kit
201-12-0421	SunredBio	96 tests	EUR 440
This Estrogen-induced protein pS2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit
DLR-PIP-Hu-48T	DL Develop	48T	EUR 554
Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit
DLR-PIP-Hu-96T	DL Develop	96T	EUR 725
Should the Human Prolactin Induced Protein (PIP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prolactin Induced Protein (PIP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Estrogen-induced protein pS2 ELISA Kit
CN-04380H1	ChemNorm	96T	EUR 441

Human Estrogen-induced protein pS2 ELISA Kit
CN-04380H2	ChemNorm	48T	EUR 291

Human Prolactin Induced Protein (PIP) ELISA Kit
RD-PIP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Prolactin Induced Protein (PIP) ELISA Kit
RD-PIP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Prolactin Induced Protein (PIP) ELISA Kit
RDR-PIP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Prolactin Induced Protein (PIP) ELISA Kit
RDR-PIP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Prolactin Induced Protein(PIP)ELISA Kit
QY-E03948	Qayee Biotechnology	96T	EUR 361

Human Estrogen-induced protein pS2 ELISA Kit
QY-E03983	Qayee Biotechnology	96T	EUR 361

Human Prolactin Induced Protein (PIP) ELISA Kit
SEM035Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit
SEM035Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit
SEM035Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit
SEM035Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prolactin Induced Protein (PIP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prolactin Induced Protein (PIP) in serum, plasma, tissue homogenates and other biological fluids.

Human Prolactin Induced Protein (PIP) ELISA Kit
4-SEM035Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Prolactin Induced Protein elisa. Alternative names of the recognized antigen: GCDFP15 GPIP4 BRST2 SABP gp17 Gross cystic disease fluid protein 15 Prolactin-induced protein Secretory actin-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prolactin Induced Protein (PIP) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

DEXI ORF Vector (Human) (pORF)
ORF003060	ABM	1.0 ug DNA	EUR 95

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

DEXI Protein Vector (Human) (pPB-C-His)
PV012237	ABM	500 ng	EUR 329

DEXI Protein Vector (Human) (pPB-N-His)
PV012238	ABM	500 ng	EUR 329

DEXI Protein Vector (Human) (pPM-C-HA)
PV012239	ABM	500 ng	EUR 329

DEXI Protein Vector (Human) (pPM-C-His)
PV012240	ABM	500 ng	EUR 329

Dexamethasone (Glucocorticoid receptor ligand)
SIH-259-1G	Stressmarq	1 g	EUR 121
Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs. It is an anti-inflammatory and immunosuppressant. In cancer patients, it can be give to augment the antiemetic effect of 5-HT3 receptor antagonists, and is also Show more
Description: The substance Dexamethasone is a glucocorticoid receptor ligand. It is synthetically produced and has a purity of >98%. The pure substance is white solid which is soluble to 100 mM in DMSO.

Dexamethasone (Glucocorticoid receptor ligand)
SIH-259-5G	Stressmarq	5 g	EUR 289
Dexamethasone is a potent synthetic member of the glucocorticoid class of steroid drugs. It is an anti-inflammatory and immunosuppressant. In cancer patients, it can be give to augment the antiemetic effect of 5-HT3 receptor antagonists, and is also Show more
Description: The substance Dexamethasone is a glucocorticoid receptor ligand. It is synthetically produced and has a purity of >98%. The pure substance is white solid which is soluble to 100 mM in DMSO.

Human DEXI(Dexamethasone Induced Protein) ELISA Kit