Mouse SCG2(Secretogranin II) ELISA Kit

Mouse SCG2(Secretogranin II) ELISA Kit

Mouse Secretogranin II (SCG2) ELISA Kit
RDR-SCG2-Mu-48Tests 48 Tests
EUR 557
Mouse Secretogranin II (SCG2) ELISA Kit
RDR-SCG2-Mu-96Tests 96 Tests
EUR 774
Human Secretogranin II (SCG2) ELISA Kit
DLR-SCG2-Hu-48T 48T
EUR 517
  • Should the Human Secretogranin II (SCG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin II (SCG2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Secretogranin II (SCG2) ELISA Kit
DLR-SCG2-Hu-96T 96T
EUR 673
  • Should the Human Secretogranin II (SCG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin II (SCG2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Secretogranin II (SCG2) ELISA Kit
RD-SCG2-Hu-48Tests 48 Tests
EUR 521
Human Secretogranin II (SCG2) ELISA Kit
RD-SCG2-Hu-96Tests 96 Tests
EUR 723
Human Secretogranin II (SCG2) ELISA Kit
RDR-SCG2-Hu-48Tests 48 Tests
EUR 544
Human Secretogranin II (SCG2) ELISA Kit
RDR-SCG2-Hu-96Tests 96 Tests
EUR 756
Mouse Secretogranin II (SCG2) ELISA Kit
abx572983-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Secretogranin II (SCG2) ELISA Kit
SEF859Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretogranin II (SCG2) in serum, plasma and other biological fluids.
Mouse Secretogranin II (SCG2) ELISA Kit
SEF859Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretogranin II (SCG2) in serum, plasma and other biological fluids.
Mouse Secretogranin II (SCG2) ELISA Kit
SEF859Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretogranin II (SCG2) in serum, plasma and other biological fluids.
Mouse Secretogranin II (SCG2) ELISA Kit
SEF859Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretogranin II (SCG2) in serum, plasma and other biological fluids.
Mouse Secretogranin II (SCG2) ELISA Kit
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Secretogranin II elisa. Alternative names of the recognized antigen: SN
  • SgII
  • CHGC
  • Chromogranin C
  • Secretoneurin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Secretogranin II (SCG2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Secretogranin II (SCG2) Protein
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Secretogranin II (SCG2) Protein
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Mouse Secretogranin II (SCG2) Protein
  • EUR 704.00
  • EUR 286.00
  • EUR 2179.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Secretogranin II (SCG2) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Secretogranin II (SCG2) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Secretogranin II (SCG2) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Secretogranin II (SCG2) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Secretogranin II (SCG2) Antibody
abx022605-02ml 0.2 ml
EUR 1219
  • Shipped within 5-10 working days.
Secretogranin II (SCG2) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Secretogranin II (SCG2)
  • EUR 517.54
  • EUR 241.00
  • EUR 1665.76
  • EUR 621.92
  • EUR 1143.84
  • EUR 409.00
  • EUR 4014.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P13521
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 71.5kDa
  • Isoelectric Point: 4.7
Description: Recombinant Human Secretogranin II expressed in: E.coli
Recombinant Secretogranin II (SCG2)
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q03517
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.9kDa
  • Isoelectric Point: 4.8
Description: Recombinant Mouse Secretogranin II expressed in: E.coli
Recombinant Secretogranin II (SCG2)
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q03517
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Secretogranin II expressed in: E.coli
Recombinant Secretogranin II (SCG2)
  • EUR 504.99
  • EUR 238.00
  • EUR 1618.72
  • EUR 606.24
  • EUR 1112.48
  • EUR 401.00
  • EUR 3896.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q03517
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 52.9kDa
  • Isoelectric Point: 5.8
Description: Recombinant Mouse Secretogranin II expressed in: E.coli
ELISA kit for Mouse SCG2 (Secretogranin II)
ELK6924 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Secretogranin II (SCG2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Secretogra
  • Show more
Description: A sandwich ELISA kit for detection of Secretogranin II from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Cow Secretogranin II (SCG2) ELISA Kit
abx520065-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Pig Secretogranin II (SCG2) ELISA Kit
abx520068-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Secretogranin II (SCG2) ELISA Kit
abx520069-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Monkey Secretogranin II (SCG2) ELISA Kit
abx359625-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Secretogranin II (SCG2) ELISA Kit
abx361394-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Secretogranin II (SCG2) ELISA Kit
abx362118-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Secretogranin II (SCG2) ELISA Kit
abx573740-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human SCG2(Secretogranin II) ELISA Kit
EH3751 96T
EUR 524.1
  • Detection range: 1.25-80 ng/ml
  • Uniprot ID: O00255
  • Alias: SCG2/CHGC/EM66/SN/SgII/Chromogranin-C/Secretogranin-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.75 ng/ml
Chicken Secretogranin II (SCG2) ELISA Kit
abx356258-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Secretogranin II (SCG2) ELISA Kit
abx253140-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Secretogranin II ELISA Kit (SCG2)
RK02249 96 Tests
EUR 521
Human Secretogranin II(SCG2)ELISA Kit
QY-E03577 96T
EUR 374
Human Secretogranin II (SCG2) ELISA Kit
SEF859Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin II (SCG2) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin II (SCG2) ELISA Kit
SEF859Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin II (SCG2) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin II (SCG2) ELISA Kit
SEF859Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin II (SCG2) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin II (SCG2) ELISA Kit
SEF859Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin II (SCG2) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin II (SCG2) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Secretogranin II elisa. Alternative names of the recognized antigen: SN
  • SgII
  • CHGC
  • Chromogranin C
  • Secretoneurin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Secretogranin II (SCG2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln342~Leu609)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2)
Secretogranin II (SCG2) Polyclonal Antibody (Mouse)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Pro430~Asp586)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2)
Secretogranin II (SCG2) Polyclonal Antibody (Mouse)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Ala11~Ile187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2)
Polyclonal SCG2 / Secretogranin II Antibody
APR13207G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SCG2 / Secretogranin II . This antibody is tested and proven to work in the following applications:
Human Secretogranin II (SCG2) Protein
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Secretogranin II (SCG2) Antibody (Biotin)
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
ELISA kit for Human SCG2 (Secretogranin II)
ELK3393 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Secretogranin II (SCG2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Secretogra
  • Show more
Description: A sandwich ELISA kit for detection of Secretogranin II from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Secretogranin II (SCG2) CLIA Kit
abx197660-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln342~Leu609)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln342~Leu609)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Biotin.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln342~Leu609)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Cy3.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln342~Leu609)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with FITC.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln342~Leu609)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with HRP.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln342~Leu609)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with PE.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Pro430~Asp586)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Pro430~Asp586)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Biotin.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Pro430~Asp586)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Cy3.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Pro430~Asp586)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with FITC.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Pro430~Asp586)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with HRP.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Pro430~Asp586)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with PE.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Ala11~Ile187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Ala11~Ile187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Biotin.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Ala11~Ile187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Cy3.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Ala11~Ile187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with FITC.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Ala11~Ile187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with HRP.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Ala11~Ile187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with PE.
CLIA kit for Human SCG2 (Secretogranin II)
E-CL-H0593 1 plate of 96 wells
EUR 584
  • Gentaur's SCG2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human SCG2 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human SCG2 (Secretogranin II) in samples from Serum, Plasma, Cell supernatant
Secretogranin II (SCG2) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln31~Met617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2)
Mouse Scg2/ Secretogranin-2 ELISA Kit
E1308Mo 1 Kit
EUR 571
Mouse Secretogranin- 2, Scg2 ELISA KIT
ELI-07400m 96 Tests
EUR 865
Mouse Scg2( Secretogranin-2) ELISA Kit
EM0760 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: Q03517
  • Alias: Scg2/SCG2/CHGC/EM66/SN/SgII/Chromogranin-C/Secretogranin-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml
Mouse Secretogranin 2 (Scg2) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Secretogranin 2 (Scg2) ELISA Kit
abx255108-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln342~Leu609)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC-Cy7.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Pro430~Asp586)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC-Cy7.
Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Ala11~Ile187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC-Cy7.
Secretogranin II (SCG2) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln31~Met617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with APC.
Secretogranin II (SCG2) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln31~Met617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with Biotin.
Secretogranin II (SCG2) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln31~Met617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with Cy3.
Secretogranin II (SCG2) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln31~Met617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with FITC.
Secretogranin II (SCG2) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln31~Met617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with HRP.
Secretogranin II (SCG2) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln31~Met617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with PE.
ELISA kit for Mouse Secretogranin-2 (SCG2)
KTE70475-48T 48T
EUR 332
  • SCG2 is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides i
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Secretogranin-2 (SCG2)
KTE70475-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SCG2 is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides i
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Secretogranin-2 (SCG2)
KTE70475-96T 96T
EUR 539
  • SCG2 is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides i
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Scg2 ELISA Kit| Mouse Secretogranin-2 ELISA Kit
EF013370 96 Tests
EUR 689
Mouse Secretogranin 2 (Scg2) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human SCG2/ Secretogranin-2 ELISA Kit
E2217Hu 1 Kit
EUR 571
Human Secretogranin- 2, SCG2 ELISA KIT
ELI-07397h 96 Tests
EUR 824
Bovine Secretogranin- 2, SCG2 ELISA KIT
ELI-07398b 96 Tests
EUR 928
Porcine Secretogranin- 2, SCG2 ELISA KIT
ELI-07399p 96 Tests
EUR 928
Human Secretogranin 2 (SCG2) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Secretogranin-2(SCG2) ELISA kit
CSB-EL020808HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Secretogranin-2 (SCG2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Secretogranin-2(SCG2) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Secretogranin-2(SCG2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Rat Secretogranin-2(SCG2) ELISA kit
CSB-EL020808RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Secretogranin-2 (SCG2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rat Secretogranin-2(SCG2) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Secretogranin-2(SCG2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
ELISA kit for Human SCG2 (Secretogranin ?)
E-EL-H0855 1 plate of 96 wells
EUR 534
  • Gentaur's SCG2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SCG2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SCG2 (Secretogranin ?) in samples from Serum, Plasma, Cell supernatant
Secretogranin II (SCG2) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCG2 (Gln31~Met617)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with APC-Cy7.
Secretogranin 2 (SCG2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Secretogranin 2 (SCG2) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ELISA kit for Human Secretogranin-2 (SCG2)
KTE60744-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Secretogranin-2 (SCG2)
KTE60744-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Secretogranin-2 (SCG2)
KTE60744-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Human Secretogranin 2 (SCG2) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Secretogranin 2 (SCG2) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Secretogranin 2 (SCG2) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Secretogranin 2 (SCG2) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Secretogranin II Antibody
abx433258-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Mouse Cytokine Primer Library II
MCA-II 1 set
EUR 450
Mouse DNA Repair Primer Library II
MDRL-II 1 set
EUR 645
Scg2/ Rat Scg2 ELISA Kit
ELI-07396r 96 Tests
EUR 886
Human Kinase Library II
HKIN-II 1 set
EUR 450
Human Drug Detoxication II
HDTX-II 1 set
EUR 645
Human Cytokine Primer Library II
HCA-II 1 set
EUR 450
Rat Cytokine Primer Library II
RCA-II 1 set
EUR 548
Secretogranin Ii (Chromogranin C) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Secretogranin II / Chromogranin C Antibody
abx237698-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Human Colon Cancer Primer Library II
HCCP-II 1 set
EUR 548
Human DNA Repair Primer Library II
HDRL-II 1 set
EUR 548
SCG2 ELISA Kit (Mouse) (OKCD08847)
OKCD08847 96 Wells
EUR 1001
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL
SCG2 ELISA Kit (Mouse) (OKEH01640)
OKEH01640 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.404 ng/mL
Human Interferon Type II Signaling Primer Library
HIFN-II 1 set
EUR 548
Human Cancer Driver Gene II Primer Library
HCDG-II 1 set
EUR 645
Anti-Secretogranin II/Chromogranin C antibody
PAab07698 100 ug
EUR 386
Anti-secretogranin II (aa203-217) antibody
STJ73051 100 µg
EUR 359
EF004722 96 Tests
EUR 689
Mouse Secretogranin III (SCG3) ELISA Kit
abx515838-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
ELISA kit for Mouse Secretogranin-2
EK4507 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Secretogranin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.
Mouse Scg3/ Secretogranin-3 ELISA Kit
E1309Mo 1 Kit
EUR 632
Mouse Secretogranin- 3, Scg3 ELISA KIT
ELI-18312m 96 Tests
EUR 865
Mouse Secretogranin- 1, Chgb ELISA KIT
ELI-42070m 96 Tests
EUR 865
Mouse Secretogranin-1(CHGB) ELISA kit
CSB-EL005345MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Secretogranin-1 (CHGB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Secretogranin-1(CHGB) ELISA kit
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Secretogranin-1(CHGB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Scg3 ELISA Kit| Mouse Secretogranin-3 ELISA Kit
EF016151 96 Tests
EUR 689
SCG2 ELISA Kit (Rat) (OKCD02329)
OKCD02329 96 Wells
EUR 896
Description: Description of target: Secretogranin-2 is a neuroendocrine secretory granule protein, which is the precursor for biologically active peptides. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.129 ng/mL
SCG2 ELISA Kit (Human) (OKAN05875)
OKAN05875 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.49 ng/mL
SCG2 ELISA Kit (Human) (OKCD02871)
OKCD02871 96 Wells
EUR 831
Description: Description of target: Secretogranin-2 is a neuroendocrine secretory granule protein, which is the precursor for biologically active peptides. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.49 ng/mL
SCG2 ELISA Kit (Human) (OKEH07144)
OKEH07144 96 Wells
EUR 662
Description: Description of target: Secretogranin-2 is a neuroendocrine secretory granule protein, which is the precursor for biologically active peptides. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.328 ng/mL
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
EUR 202
Polyclonal secretogranin II (aa203-217) Antibody (internal region)
APR13238G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human secretogranin II (aa203-217) (internal region). This antibody is tested and proven to work in the following applications:
Mouse SCG2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SCG2 Recombinant Protein (Mouse)
RP170198 100 ug Ask for price
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SCG2 antibody
70R-4481 50 ug
EUR 467
Description: Rabbit polyclonal SCG2 antibody
Scg2 antibody
70R-8629 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Scg2 antibody
SCG2 antibody
38903-100ul 100ul
EUR 252
SCG2 antibody
70R-20103 50 ul
EUR 435
Description: Rabbit polyclonal SCG2 antibody
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SCG2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SCG2. Recognizes SCG2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SCG2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCG2. Recognizes SCG2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
PVT12262 2 ug
EUR 391
Cow Secretogranin III (SCG3) ELISA Kit
abx515836-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Secretogranin III (SCG3) ELISA Kit
abx515839-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
Human Secretogranin III (SCG3) ELISA Kit
abx571327-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
ELISA kit for Human SCG3 (Secretogranin ?)
E-EL-H5505 1 plate of 96 wells
EUR 534
  • Gentaur's SCG3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SCG3. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SCG3 (Secretogranin ?) in samples from Serum, Plasma, Cell supernatant
ELISA kit for Human Secretogranin-3
EK2988 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Secretogranin-3 in samples from serum, plasma, tissue homogenates and other biological fluids.
Human SCG3/ Secretogranin-3 ELISA Kit
E2218Hu 1 Kit
EUR 605
Human SCG3(Secretogranin-3) ELISA Kit
EH1389 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8WXD2
  • Alias: SCG3/Secretogranin-3/Secretogranin III/SgIII
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Secretogranin- 1, CHGB ELISA KIT
ELI-18328h 96 Tests
EUR 824
Porcine Secretogranin- 1, CHGB ELISA KIT
ELI-20156p 96 Tests
EUR 928
Human Secretogranin- 3, SCG3 ELISA KIT
ELI-30474h 96 Tests
EUR 824
Bovine Secretogranin- 1, CHGB ELISA KIT
ELI-42069b 96 Tests
EUR 928
Human Secretogranin III (SCG3) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Secretogranin V (SCG5) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Secretogranin 3 (SCG3) ELISA Kit
abx250662-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human Secretogranin III (SCG3) ELISA Kit
DLR-SCG3-Hu-48T 48T
EUR 517
  • Should the Human Secretogranin III (SCG3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin III (SCG3) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Secretogranin III (SCG3) ELISA Kit
DLR-SCG3-Hu-96T 96T
EUR 673
  • Should the Human Secretogranin III (SCG3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin III (SCG3) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Secretogranin V (SCG5) ELISA Kit
DLR-SCG5-Hu-48T 48T
EUR 517
  • Should the Human Secretogranin V (SCG5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin V (SCG5) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Secretogranin V (SCG5) ELISA Kit
DLR-SCG5-Hu-96T 96T
EUR 673
  • Should the Human Secretogranin V (SCG5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin V (SCG5) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat Secretogranin-3(SCG3) ELISA kit
CSB-EL020809RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Secretogranin-3 (SCG3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Rat Secretogranin-3(SCG3) ELISA kit
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Secretogranin-3(SCG3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Secretogranin V (SCG5) ELISA Kit
SEC834Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin V (SCG5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin V (SCG5) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin V (SCG5) ELISA Kit
SEC834Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin V (SCG5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin V (SCG5) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin V (SCG5) ELISA Kit
SEC834Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin V (SCG5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin V (SCG5) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin V (SCG5) ELISA Kit
SEC834Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin V (SCG5) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin V (SCG5) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin V (SCG5) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Secretogranin V elisa. Alternative names of the recognized antigen: SCGV
  • P7B2
  • SGNE1
  • SgV
  • 7B2 Protein
  • Neuroendocrine protein 7B2
  • Prohormone Convertase Chaperone
  • Pituitary polypeptide
  • Secretory granule endocrine protein I
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Secretogranin V (SCG5) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Secretogranin V ELISA Kit (SCG5)
RK02250 96 Tests
EUR 521
Human Secretogranin III (SCG3) ELISA Kit
RD-SCG3-Hu-48Tests 48 Tests
EUR 521
Human Secretogranin III (SCG3) ELISA Kit
RD-SCG3-Hu-96Tests 96 Tests
EUR 723
Human Secretogranin V (SCG5) ELISA Kit
RD-SCG5-Hu-48Tests 48 Tests
EUR 521
Human Secretogranin V (SCG5) ELISA Kit
RD-SCG5-Hu-96Tests 96 Tests
EUR 723
Human Secretogranin III (SCG3) ELISA Kit
RDR-SCG3-Hu-48Tests 48 Tests
EUR 544
Human Secretogranin III (SCG3) ELISA Kit
RDR-SCG3-Hu-96Tests 96 Tests
EUR 756
Human Secretogranin V (SCG5) ELISA Kit
RDR-SCG5-Hu-48Tests 48 Tests
EUR 544
Human Secretogranin V (SCG5) ELISA Kit
RDR-SCG5-Hu-96Tests 96 Tests
EUR 756
Human Secretogranin V(SCG5)ELISA Kit
QY-E03575 96T
EUR 374
Human Secretogranin III(SCG3)ELISA Kit
QY-E03576 96T
EUR 374
Human Secretogranin III (SCG3) ELISA Kit
SEF860Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin III (SCG3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin III (SCG3) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin III (SCG3) ELISA Kit
SEF860Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin III (SCG3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin III (SCG3) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin III (SCG3) ELISA Kit
SEF860Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin III (SCG3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin III (SCG3) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin III (SCG3) ELISA Kit
SEF860Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin III (SCG3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin III (SCG3) in serum, plasma, tissue homogenates and other biological fluids.
Human Secretogranin III (SCG3) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Secretogranin III elisa. Alternative names of the recognized antigen: SGIII
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Secretogranin III (SCG3) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Scg3 ELISA Kit| Rat Secretogranin-3 ELISA Kit
EF019297 96 Tests
EUR 689
Mouse Angiotensin II (Ang II) ELISA Kit
abx575127-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.
EMM0285 96Tests
EUR 521
Mouse Angiotensin II (Ang II) ELISA Kit
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Scg2 ORF Vector (Mouse) (pORF)
ORF056734 1.0 ug DNA
EUR 506
F II ELISA Kit| Mouse coagulation factor II ELISA Kit
EF013589 96 Tests
EUR 689
HC II ELISA Kit| Mouse Heparin Cofactor II ELISA Kit
EF013669 96 Tests
EUR 689
ELISA kit for Human SCG5 (Secretogranin V)
ELK3704 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Secretogranin V (SCG5). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Secretogran
  • Show more
Description: A sandwich ELISA kit for detection of Secretogranin V from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human SCG3 (Secretogranin III)
ELK3991 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Secretogranin III (SCG3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Secretogr
  • Show more
Description: A sandwich ELISA kit for detection of Secretogranin III from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Secretogranin-3 (SCG3)
KTE60743-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-3 (SCG3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Secretogranin-3 (SCG3)
KTE60743-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-3 (SCG3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Secretogranin-3 (SCG3)
KTE60743-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-3 (SCG3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
SCG2 Conjugated Antibody
C38903 100ul
EUR 397
SCG2 cloning plasmid
CSB-CL020808HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1854
  • Sequence: atggctgaagcaaagacccactggcttggagcagccctgtctcttatccctttaattttcctcatctctggggctgaagcagcttcatttcagagaaaccagctgcttcagaaagaaccagacctcaggttggaaaatgtccaaaagtttcccagtcctgaaatgatcagggctt
  • Show more
Description: A cloning plasmid for the SCG2 gene.

Mouse SCG2(Secretogranin II) ELISA Kit