Mouse SCG2(Secretogranin II) ELISA Kit

Mouse SCG2(Secretogranin II) ELISA Kit

Mouse Secretogranin II (SCG2) ELISA Kit
RDR-SCG2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Secretogranin II (SCG2) ELISA Kit
RDR-SCG2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Secretogranin II (SCG2) ELISA Kit
DLR-SCG2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Secretogranin II (SCG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin II (SCG2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Secretogranin II (SCG2) ELISA Kit
DLR-SCG2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Secretogranin II (SCG2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin II (SCG2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Secretogranin II (SCG2) ELISA Kit
RD-SCG2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Secretogranin II (SCG2) ELISA Kit
RD-SCG2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Secretogranin II (SCG2) ELISA Kit
RDR-SCG2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Secretogranin II (SCG2) ELISA Kit
RDR-SCG2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Secretogranin II (SCG2) ELISA Kit
abx572983-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Secretogranin II (SCG2) ELISA Kit
SEF859Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretogranin II (SCG2) in serum, plasma and other biological fluids.

Mouse Secretogranin II (SCG2) ELISA Kit
SEF859Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretogranin II (SCG2) in serum, plasma and other biological fluids.

Mouse Secretogranin II (SCG2) ELISA Kit
SEF859Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretogranin II (SCG2) in serum, plasma and other biological fluids.

Mouse Secretogranin II (SCG2) ELISA Kit
SEF859Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretogranin II (SCG2) in serum, plasma and other biological fluids.

Mouse Secretogranin II (SCG2) ELISA Kit
4-SEF859Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Secretogranin II elisa. Alternative names of the recognized antigen: SN SgII CHGC Chromogranin C Secretoneurin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Secretogranin II (SCG2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Secretogranin II (SCG2) Protein
20-abx069001	Abbexa	EUR 704.00 EUR 286.00 EUR 2179.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Secretogranin II (SCG2) Protein
20-abx069002	Abbexa	EUR 704.00 EUR 286.00 EUR 2179.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Secretogranin II (SCG2) Protein
20-abx069003	Abbexa	EUR 704.00 EUR 286.00 EUR 2179.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Secretogranin II (SCG2) Antibody
20-abx128296	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Secretogranin II (SCG2) Antibody
20-abx101580	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Secretogranin II (SCG2) Antibody
20-abx101581	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Secretogranin II (SCG2) Antibody
20-abx101582	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Secretogranin II (SCG2) Antibody
abx022605-02ml	Abbexa	0.2 ml	EUR 1219
Shipped within 5-10 working days.

Secretogranin II (SCG2) Antibody
20-abx174483	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Secretogranin II (SCG2)
4-RPF859Hu01	Cloud-Clone	EUR 517.54 EUR 241.00 EUR 1665.76 EUR 621.92 EUR 1143.84 EUR 409.00 EUR 4014.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P13521 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 71.5kDa Isoelectric Point: 4.7
Description: Recombinant Human Secretogranin II expressed in: E.coli

Recombinant Secretogranin II (SCG2)
4-RPF859Mu01	Cloud-Clone	EUR 504.99 EUR 238.00 EUR 1618.72 EUR 606.24 EUR 1112.48 EUR 401.00 EUR 3896.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q03517 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.9kDa Isoelectric Point: 4.8
Description: Recombinant Mouse Secretogranin II expressed in: E.coli

Recombinant Secretogranin II (SCG2)
4-RPF859Mu02	Cloud-Clone	EUR 504.99 EUR 238.00 EUR 1618.72 EUR 606.24 EUR 1112.48 EUR 401.00 EUR 3896.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q03517 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.4kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Secretogranin II expressed in: E.coli

Recombinant Secretogranin II (SCG2)
4-RPF859Mu03	Cloud-Clone	EUR 504.99 EUR 238.00 EUR 1618.72 EUR 606.24 EUR 1112.48 EUR 401.00 EUR 3896.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q03517 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 52.9kDa Isoelectric Point: 5.8
Description: Recombinant Mouse Secretogranin II expressed in: E.coli

ELISA kit for Mouse SCG2 (Secretogranin II)
ELK6924	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Secretogranin II (SCG2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Secretogra Show more
Description: A sandwich ELISA kit for detection of Secretogranin II from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Cow Secretogranin II (SCG2) ELISA Kit
abx520065-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Pig Secretogranin II (SCG2) ELISA Kit
abx520068-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Secretogranin II (SCG2) ELISA Kit
abx520069-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Monkey Secretogranin II (SCG2) ELISA Kit
abx359625-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Secretogranin II (SCG2) ELISA Kit
abx361394-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Secretogranin II (SCG2) ELISA Kit
abx362118-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Secretogranin II (SCG2) ELISA Kit
abx573740-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human SCG2(Secretogranin II) ELISA Kit
EH3751	FN Test	96T	EUR 524.1
Detection range: 1.25-80 ng/ml Uniprot ID: O00255 Alias: SCG2/CHGC/EM66/SN/SgII/Chromogranin-C/Secretogranin-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.75 ng/ml

Chicken Secretogranin II (SCG2) ELISA Kit
abx356258-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Secretogranin II (SCG2) ELISA Kit
abx253140-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Secretogranin II ELISA Kit (SCG2)
RK02249	Abclonal	96 Tests	EUR 521

Human Secretogranin II(SCG2)ELISA Kit
QY-E03577	Qayee Biotechnology	96T	EUR 374

Human Secretogranin II (SCG2) ELISA Kit
SEF859Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin II (SCG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin II (SCG2) ELISA Kit
SEF859Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin II (SCG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin II (SCG2) ELISA Kit
SEF859Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin II (SCG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin II (SCG2) ELISA Kit
SEF859Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin II (SCG2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin II (SCG2) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin II (SCG2) ELISA Kit
4-SEF859Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Secretogranin II elisa. Alternative names of the recognized antigen: SN SgII CHGC Chromogranin C Secretoneurin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Secretogranin II (SCG2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse)
4-PAF859Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln342~Leu609) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2)

Secretogranin II (SCG2) Polyclonal Antibody (Mouse)
4-PAF859Mu02	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Pro430~Asp586) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2)

Secretogranin II (SCG2) Polyclonal Antibody (Mouse)
4-PAF859Mu03	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Ala11~Ile187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2)

Polyclonal SCG2 / Secretogranin II Antibody
APR13207G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SCG2 / Secretogranin II . This antibody is tested and proven to work in the following applications:

Human Secretogranin II (SCG2) Protein
20-abx168283	Abbexa	EUR 718.00 EUR 286.00 EUR 2249.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Secretogranin II (SCG2) Antibody (Biotin)
20-abx273019	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Human SCG2 (Secretogranin II)
ELK3393	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Secretogranin II (SCG2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Secretogra Show more
Description: A sandwich ELISA kit for detection of Secretogranin II from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Secretogranin II (SCG2) CLIA Kit
abx197660-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC
4-PAF859Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln342~Leu609) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Biotinylated
4-PAF859Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln342~Leu609) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Biotin.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Cy3
4-PAF859Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln342~Leu609) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Cy3.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), FITC
4-PAF859Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln342~Leu609) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with FITC.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), HRP
4-PAF859Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln342~Leu609) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with HRP.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), PE
4-PAF859Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln342~Leu609) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with PE.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC
4-PAF859Mu02-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Pro430~Asp586) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Biotinylated
4-PAF859Mu02-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Pro430~Asp586) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Biotin.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Cy3
4-PAF859Mu02-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Pro430~Asp586) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Cy3.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), FITC
4-PAF859Mu02-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Pro430~Asp586) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with FITC.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), HRP
4-PAF859Mu02-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Pro430~Asp586) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with HRP.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), PE
4-PAF859Mu02-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Pro430~Asp586) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with PE.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC
4-PAF859Mu03-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Ala11~Ile187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Biotinylated
4-PAF859Mu03-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Ala11~Ile187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Biotin.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), Cy3
4-PAF859Mu03-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Ala11~Ile187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with Cy3.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), FITC
4-PAF859Mu03-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Ala11~Ile187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with FITC.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), HRP
4-PAF859Mu03-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Ala11~Ile187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with HRP.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), PE
4-PAF859Mu03-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Ala11~Ile187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with PE.

CLIA kit for Human SCG2 (Secretogranin II)
E-CL-H0593	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's SCG2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human SCG2 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human SCG2 (Secretogranin II) in samples from Serum, Plasma, Cell supernatant

Secretogranin II (SCG2) Polyclonal Antibody (Human)
4-PAF859Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln31~Met617) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2)

Mouse Scg2/ Secretogranin-2 ELISA Kit
E1308Mo	Sunlong	1 Kit	EUR 571

Mouse Secretogranin- 2, Scg2 ELISA KIT
ELI-07400m	Lifescience Market	96 Tests	EUR 865

Mouse Scg2( Secretogranin-2) ELISA Kit
EM0760	FN Test	96T	EUR 567.6
Detection range: 0.78-50 ng/ml Uniprot ID: Q03517 Alias: Scg2/SCG2/CHGC/EM66/SN/SgII/Chromogranin-C/Secretogranin-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.469 ng/ml

Mouse Secretogranin 2 (Scg2) ELISA Kit
20-abx154651	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Secretogranin 2 (Scg2) ELISA Kit
abx255108-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAF859Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln342~Leu609) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC-Cy7.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAF859Mu02-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Pro430~Asp586) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC-Cy7.

Secretogranin II (SCG2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAF859Mu03-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Ala11~Ile187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Secretogranin II (SCG2). This antibody is labeled with APC-Cy7.

Secretogranin II (SCG2) Polyclonal Antibody (Human), APC
4-PAF859Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln31~Met617) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with APC.

Secretogranin II (SCG2) Polyclonal Antibody (Human), Biotinylated
4-PAF859Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln31~Met617) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with Biotin.

Secretogranin II (SCG2) Polyclonal Antibody (Human), Cy3
4-PAF859Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln31~Met617) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with Cy3.

Secretogranin II (SCG2) Polyclonal Antibody (Human), FITC
4-PAF859Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln31~Met617) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with FITC.

Secretogranin II (SCG2) Polyclonal Antibody (Human), HRP
4-PAF859Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln31~Met617) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with HRP.

Secretogranin II (SCG2) Polyclonal Antibody (Human), PE
4-PAF859Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln31~Met617) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with PE.

ELISA kit for Mouse Secretogranin-2 (SCG2)
KTE70475-48T	Abbkine	48T	EUR 332
SCG2 is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides i Show more
Description: Quantitative sandwich ELISA for measuring Mouse Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Secretogranin-2 (SCG2)
KTE70475-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
SCG2 is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides i Show more
Description: Quantitative sandwich ELISA for measuring Mouse Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Secretogranin-2 (SCG2)
KTE70475-96T	Abbkine	96T	EUR 539
SCG2 is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides i Show more
Description: Quantitative sandwich ELISA for measuring Mouse Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Scg2 ELISA Kit| Mouse Secretogranin-2 ELISA Kit
EF013370	Lifescience Market	96 Tests	EUR 689

Mouse Secretogranin 2 (Scg2) CLIA Kit
20-abx495026	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human SCG2/ Secretogranin-2 ELISA Kit
E2217Hu	Sunlong	1 Kit	EUR 571

Human Secretogranin- 2, SCG2 ELISA KIT
ELI-07397h	Lifescience Market	96 Tests	EUR 824

Bovine Secretogranin- 2, SCG2 ELISA KIT
ELI-07398b	Lifescience Market	96 Tests	EUR 928

Porcine Secretogranin- 2, SCG2 ELISA KIT
ELI-07399p	Lifescience Market	96 Tests	EUR 928

Human Secretogranin 2 (SCG2) ELISA Kit
20-abx153038	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Secretogranin-2(SCG2) ELISA kit
CSB-EL020808HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Secretogranin-2 (SCG2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Secretogranin-2(SCG2) ELISA kit
1-CSB-EL020808HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Secretogranin-2(SCG2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Secretogranin-2(SCG2) ELISA kit
CSB-EL020808RA-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Secretogranin-2 (SCG2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Secretogranin-2(SCG2) ELISA kit
1-CSB-EL020808RA	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Secretogranin-2(SCG2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human SCG2 (Secretogranin ?)
E-EL-H0855	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SCG2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SCG2. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SCG2 (Secretogranin ?) in samples from Serum, Plasma, Cell supernatant

Secretogranin II (SCG2) Polyclonal Antibody (Human), APC-Cy7
4-PAF859Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SCG2 (Gln31~Met617) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Secretogranin II (SCG2). This antibody is labeled with APC-Cy7.

Secretogranin 2 (SCG2) Antibody
20-abx004918	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Secretogranin 2 (SCG2) Antibody
20-abx313071	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Human Secretogranin-2 (SCG2)
KTE60744-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Secretogranin-2 (SCG2)
KTE60744-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Secretogranin-2 (SCG2)
KTE60744-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-2 (SCG2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Secretogranin 2 (SCG2) CLIA Kit
20-abx495025	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Secretogranin 2 (SCG2) Antibody (HRP)
20-abx313072	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Secretogranin 2 (SCG2) Antibody (FITC)
20-abx313073	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Secretogranin 2 (SCG2) Antibody (Biotin)
20-abx313074	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Secretogranin II Antibody
abx433258-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Mouse Cytokine Primer Library II
MCA-II	Real Time Primers	1 set	EUR 450

Mouse DNA Repair Primer Library II
MDRL-II	Real Time Primers	1 set	EUR 645

Scg2/ Rat Scg2 ELISA Kit
ELI-07396r	Lifescience Market	96 Tests	EUR 886

Human Kinase Library II
HKIN-II	Real Time Primers	1 set	EUR 450

Human Drug Detoxication II
HDTX-II	Real Time Primers	1 set	EUR 645

Human Cytokine Primer Library II
HCA-II	Real Time Primers	1 set	EUR 450

Rat Cytokine Primer Library II
RCA-II	Real Time Primers	1 set	EUR 548

Secretogranin Ii (Chromogranin C) Antibody
20-abx115412	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Secretogranin II / Chromogranin C Antibody
abx237698-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Human Colon Cancer Primer Library II
HCCP-II	Real Time Primers	1 set	EUR 548

Human DNA Repair Primer Library II
HDRL-II	Real Time Primers	1 set	EUR 548

SCG2 ELISA Kit (Mouse) (OKCD08847)
OKCD08847	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL

SCG2 ELISA Kit (Mouse) (OKEH01640)
OKEH01640	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.404 ng/mL

Human Interferon Type II Signaling Primer Library
HIFN-II	Real Time Primers	1 set	EUR 548

Human Cancer Driver Gene II Primer Library
HCDG-II	Real Time Primers	1 set	EUR 645

Anti-Secretogranin II/Chromogranin C antibody
PAab07698	Lifescience Market	100 ug	EUR 386

Anti-secretogranin II (aa203-217) antibody
STJ73051	St John's Laboratory	100 µg	EUR 359

SCG2 ELISA KIT|Human
EF004722	Lifescience Market	96 Tests	EUR 689

Mouse Secretogranin III (SCG3) ELISA Kit
abx515838-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Mouse Secretogranin-2
EK4507	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Secretogranin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Scg3/ Secretogranin-3 ELISA Kit
E1309Mo	Sunlong	1 Kit	EUR 632

Mouse Secretogranin- 3, Scg3 ELISA KIT
ELI-18312m	Lifescience Market	96 Tests	EUR 865

Mouse Secretogranin- 1, Chgb ELISA KIT
ELI-42070m	Lifescience Market	96 Tests	EUR 865

Mouse Secretogranin-1(CHGB) ELISA kit
CSB-EL005345MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Secretogranin-1 (CHGB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Secretogranin-1(CHGB) ELISA kit
1-CSB-EL005345MO	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Secretogranin-1(CHGB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Scg3 ELISA Kit| Mouse Secretogranin-3 ELISA Kit
EF016151	Lifescience Market	96 Tests	EUR 689

SCG2 ELISA Kit (Rat) (OKCD02329)
OKCD02329	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: Secretogranin-2 is a neuroendocrine secretory granule protein, which is the precursor for biologically active peptides. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.129 ng/mL

SCG2 ELISA Kit (Human) (OKAN05875)
OKAN05875	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.49 ng/mL

SCG2 ELISA Kit (Human) (OKCD02871)
OKCD02871	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Secretogranin-2 is a neuroendocrine secretory granule protein, which is the precursor for biologically active peptides. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.49 ng/mL

SCG2 ELISA Kit (Human) (OKEH07144)
OKEH07144	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Secretogranin-2 is a neuroendocrine secretory granule protein, which is the precursor for biologically active peptides. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.328 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Polyclonal secretogranin II (aa203-217) Antibody (internal region)
APR13238G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human secretogranin II (aa203-217) (internal region). This antibody is tested and proven to work in the following applications:

Mouse SCG2 shRNA Plasmid
20-abx972577	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SCG2 Recombinant Protein (Mouse)
RP170198	ABM	100 ug	Ask for price

SCG2 siRNA
20-abx904792	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SCG2 antibody
70R-4481	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SCG2 antibody

Scg2 antibody
70R-8629	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Scg2 antibody

SCG2 antibody
38903-100ul	SAB	100ul	EUR 252

SCG2 antibody
70R-20103	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SCG2 antibody

SCG2 siRNA
20-abx932569	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SCG2 siRNA
20-abx932570	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SCG2 Antibody
1-CSB-PA020808GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SCG2. Recognizes SCG2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SCG2 Antibody
1-CSB-PA020808LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCG2. Recognizes SCG2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

pENTR223-SCG2
PVT12262	Lifescience Market	2 ug	EUR 391

Cow Secretogranin III (SCG3) ELISA Kit
abx515836-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Secretogranin III (SCG3) ELISA Kit
abx515839-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Secretogranin III (SCG3) ELISA Kit
abx571327-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human SCG3 (Secretogranin ?)
E-EL-H5505	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's SCG3 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SCG3. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SCG3 (Secretogranin ?) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Secretogranin-3
EK2988	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Secretogranin-3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human SCG3/ Secretogranin-3 ELISA Kit
E2218Hu	Sunlong	1 Kit	EUR 605

Human SCG3(Secretogranin-3) ELISA Kit
EH1389	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q8WXD2 Alias: SCG3/Secretogranin-3/Secretogranin III/SgIII
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Secretogranin- 1, CHGB ELISA KIT
ELI-18328h	Lifescience Market	96 Tests	EUR 824

Porcine Secretogranin- 1, CHGB ELISA KIT
ELI-20156p	Lifescience Market	96 Tests	EUR 928

Human Secretogranin- 3, SCG3 ELISA KIT
ELI-30474h	Lifescience Market	96 Tests	EUR 824

Bovine Secretogranin- 1, CHGB ELISA KIT
ELI-42069b	Lifescience Market	96 Tests	EUR 928

Human Secretogranin III (SCG3) ELISA Kit
20-abx153039	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Secretogranin V (SCG5) ELISA Kit
20-abx153040	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Secretogranin 3 (SCG3) ELISA Kit
abx250662-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Secretogranin III (SCG3) ELISA Kit
DLR-SCG3-Hu-48T	DL Develop	48T	EUR 517
Should the Human Secretogranin III (SCG3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin III (SCG3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Secretogranin III (SCG3) ELISA Kit
DLR-SCG3-Hu-96T	DL Develop	96T	EUR 673
Should the Human Secretogranin III (SCG3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin III (SCG3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Secretogranin V (SCG5) ELISA Kit
DLR-SCG5-Hu-48T	DL Develop	48T	EUR 517
Should the Human Secretogranin V (SCG5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin V (SCG5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Secretogranin V (SCG5) ELISA Kit
DLR-SCG5-Hu-96T	DL Develop	96T	EUR 673
Should the Human Secretogranin V (SCG5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Secretogranin V (SCG5) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Secretogranin-3(SCG3) ELISA kit
CSB-EL020809RA-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Secretogranin-3 (SCG3) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Secretogranin-3(SCG3) ELISA kit
1-CSB-EL020809RA	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Secretogranin-3(SCG3) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Secretogranin V (SCG5) ELISA Kit
SEC834Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin V (SCG5) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin V (SCG5) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin V (SCG5) ELISA Kit
SEC834Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin V (SCG5) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin V (SCG5) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin V (SCG5) ELISA Kit
SEC834Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin V (SCG5) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin V (SCG5) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin V (SCG5) ELISA Kit
SEC834Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin V (SCG5) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin V (SCG5) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin V (SCG5) ELISA Kit
4-SEC834Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Secretogranin V elisa. Alternative names of the recognized antigen: SCGV P7B2 SGNE1 SgV 7B2 Protein Neuroendocrine protein 7B2 Prohormone Convertase Chaperone Pituitary polypeptide Secretory granule endocrine protein I
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Secretogranin V (SCG5) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Secretogranin V ELISA Kit (SCG5)
RK02250	Abclonal	96 Tests	EUR 521

Human Secretogranin III (SCG3) ELISA Kit
RD-SCG3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Secretogranin III (SCG3) ELISA Kit
RD-SCG3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Secretogranin V (SCG5) ELISA Kit
RD-SCG5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Secretogranin V (SCG5) ELISA Kit
RD-SCG5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Secretogranin III (SCG3) ELISA Kit
RDR-SCG3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Secretogranin III (SCG3) ELISA Kit
RDR-SCG3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Secretogranin V (SCG5) ELISA Kit
RDR-SCG5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Secretogranin V (SCG5) ELISA Kit
RDR-SCG5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Secretogranin V(SCG5)ELISA Kit
QY-E03575	Qayee Biotechnology	96T	EUR 374

Human Secretogranin III(SCG3)ELISA Kit
QY-E03576	Qayee Biotechnology	96T	EUR 374

Human Secretogranin III (SCG3) ELISA Kit
SEF860Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin III (SCG3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin III (SCG3) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin III (SCG3) ELISA Kit
SEF860Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin III (SCG3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin III (SCG3) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin III (SCG3) ELISA Kit
SEF860Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin III (SCG3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin III (SCG3) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin III (SCG3) ELISA Kit
SEF860Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretogranin III (SCG3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretogranin III (SCG3) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretogranin III (SCG3) ELISA Kit
4-SEF860Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Secretogranin III elisa. Alternative names of the recognized antigen: SGIII
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Secretogranin III (SCG3) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Scg3 ELISA Kit| Rat Secretogranin-3 ELISA Kit
EF019297	Lifescience Market	96 Tests	EUR 689

Mouse Angiotensin II (Ang II) ELISA Kit
abx575127-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Mouse MHC II/RLA II ELISA Kit
EMM0285	Abclonal	96Tests	EUR 521

Mouse Angiotensin II (Ang II) ELISA Kit
20-abx153637	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Scg2 ORF Vector (Mouse) (pORF)
ORF056734	ABM	1.0 ug DNA	EUR 506

F II ELISA Kit| Mouse coagulation factor II ELISA Kit
EF013589	Lifescience Market	96 Tests	EUR 689

HC II ELISA Kit| Mouse Heparin Cofactor II ELISA Kit
EF013669	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human SCG5 (Secretogranin V)
ELK3704	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Secretogranin V (SCG5). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Secretogran Show more
Description: A sandwich ELISA kit for detection of Secretogranin V from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human SCG3 (Secretogranin III)
ELK3991	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Secretogranin III (SCG3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Secretogr Show more
Description: A sandwich ELISA kit for detection of Secretogranin III from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Secretogranin-3 (SCG3)
KTE60743-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-3 (SCG3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Secretogranin-3 (SCG3)
KTE60743-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-3 (SCG3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Secretogranin-3 (SCG3)
KTE60743-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Human Secretogranin-3 (SCG3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SCG2 Conjugated Antibody
C38903	SAB	100ul	EUR 397

SCG2 cloning plasmid
CSB-CL020808HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1854 Sequence: atggctgaagcaaagacccactggcttggagcagccctgtctcttatccctttaattttcctcatctctggggctgaagcagcttcatttcagagaaaccagctgcttcagaaagaaccagacctcaggttggaaaatgtccaaaagtttcccagtcctgaaatgatcagggctt Show more
Description: A cloning plasmid for the SCG2 gene.

Mouse SCG2(Secretogranin II) ELISA Kit