Mouse VASN(Vasorin) ELISA Kit

Mouse VASN(Vasorin) ELISA Kit

Mouse Vasorin (VASN) ELISA Kit

RD-VASN-Mu-96Tests 96 Tests
EUR 740

Human Vasorin (VASN) ELISA Kit

EUR 517
  • Should the Human Vasorin (VASN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasorin (VASN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Vasorin (VASN) ELISA Kit

EUR 673
  • Should the Human Vasorin (VASN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasorin (VASN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Vasorin (VASN) ELISA Kit

RDR-VASN-Hu-48Tests 48 Tests
EUR 544

Human Vasorin (VASN) ELISA Kit

RDR-VASN-Hu-96Tests 96 Tests
EUR 756

Human Vasorin (VASN) ELISA Kit

RD-VASN-Hu-48Tests 48 Tests
EUR 521

Human Vasorin (VASN) ELISA Kit

RD-VASN-Hu-96Tests 96 Tests
EUR 723

Mouse Vasorin (VASN) ELISA Kit

abx571795-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Vasn/ Vasorin ELISA Kit

E1569Mo 1 Kit
EUR 571

Mouse Vasorin, Vasn ELISA KIT

ELI-05448m 96 Tests
EUR 865

Mouse Vasn(Vasorin) ELISA Kit

EM0665 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9CZT5
  • Alias: Vasn/Protein slit-like 2/Atia/Slitl2/VASN/Protein slit-like 2/SLITL2/slit-like 2/slit-like 2(Drosophila)/vasorin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse Vasorin (VASN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Vasorin (VASN) ELISA Kit

abx255015-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Mouse Vasorin (VASN) ELISA Kit

SEG905Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids.

Mouse Vasorin (VASN) ELISA Kit

SEG905Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids.

Mouse Vasorin (VASN) ELISA Kit

SEG905Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids.

Mouse Vasorin (VASN) ELISA Kit

SEG905Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Vasorin (VASN) in Tissue homogenates and other biological fluids.

Mouse Vasorin (VASN) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vasorin elisa. Alternative names of the recognized antigen: SLITL2
  • Slit-Like 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Vasorin (VASN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse VASN (Vasorin)

ELK7122 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasorin (VASN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Vasorin (VASN). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Vasorin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Vasorin (VASN)

KTE70030-48T 48T
EUR 332
  • Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Vasorin (VASN)

KTE70030-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Vasorin (VASN)

KTE70030-96T 96T
EUR 539
  • Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Vasorin (VASN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Vasorin (VASN) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Vasorin (VASN) ELISA Kit

abx572543-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human VASN/ Vasorin ELISA Kit

E2651Hu 1 Kit
EUR 571

Human Vasorin, VASN ELISA KIT

ELI-05447h 96 Tests
EUR 824

Human Vasorin (VASN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Vasorin ELISA Kit (VASN)

RK02486 96 Tests
EUR 521

Human Vasorin (VASN) ELISA Kit

SEG905Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.

Human Vasorin (VASN) ELISA Kit

SEG905Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.

Human Vasorin (VASN) ELISA Kit

SEG905Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.

Human Vasorin (VASN) ELISA Kit

SEG905Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasorin (VASN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasorin (VASN) in tissue homogenates, cell lysates and other biological fluids.

Human Vasorin (VASN) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vasorin elisa. Alternative names of the recognized antigen: SLITL2
  • Slit-Like 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vasorin (VASN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Vasn ELISA Kit| Mouse Vasorin ELISA Kit

EF013280 96 Tests
EUR 689

Vasorin (VASN) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Vasorin (VASN) Antibody

  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Vasorin (VASN) Antibody

abx029986-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Vasorin (VASN) Antibody

abx029986-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Vasorin (VASN) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Vasorin (VASN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Vasorin (VASN)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6EMK4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: 8.7
Description: Recombinant Human Vasorin expressed in: E.coli

Recombinant Vasorin (VASN)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CZT5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Vasorin expressed in: E.coli

Vasorin (VASN) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN)

ELISA kit for Human VASN (Vasorin)

ELK3543 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasorin (VASN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Vasorin (VASN). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Vasorin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Vasorin (VASN)

KTE60072-48T 48T
EUR 332
  • The deduced 673-amino acid protein contains a putative hydrophobic signal sequence, 10 tandem arrays of a leucine-rich repeat, an epidermal growth factor-like domain, a fibronectin type III-like domain, and a short intracellular region. In situ hybri
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasorin (VASN)

KTE60072-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The deduced 673-amino acid protein contains a putative hydrophobic signal sequence, 10 tandem arrays of a leucine-rich repeat, an epidermal growth factor-like domain, a fibronectin type III-like domain, and a short intracellular region. In situ hybri
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasorin (VASN)

KTE60072-96T 96T
EUR 539
  • The deduced 673-amino acid protein contains a putative hydrophobic signal sequence, 10 tandem arrays of a leucine-rich repeat, an epidermal growth factor-like domain, a fibronectin type III-like domain, and a short intracellular region. In situ hybri
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasorin (VASN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Vasorin (VASN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Vasorin (VASN) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN)

Vasorin (VASN) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC.

Vasorin (VASN) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Biotin.

Vasorin (VASN) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Cy3.

Vasorin (VASN) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with FITC.

Vasorin (VASN) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with HRP.

Vasorin (VASN) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with PE.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Biotin.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with Cy3.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with FITC.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with HRP.

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with PE.

Vasorin (VASN) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7.

Human CellExp? Vasorin / VASN, Human recombinant

EUR 142

Human CellExp? Vasorin / VASN, Human recombinant

EUR 479

Vasorin (VASN) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn298~Gly539)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Vasorin (VASN). This antibody is labeled with APC-Cy7.

Recombinant Human Vasorin/SLITL2/VASN (C-6His)

C394-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2.

Recombinant Human Vasorin/SLITL2/VASN (C-6His)

C394-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2.

Recombinant Human Vasorin/SLITL2/VASN (C-6His)

C394-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2.

Recombinant Human Vasorin/SLITL2/VASN (C-6His)

C394-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 5% Threhalose, pH 7.2.

ELISA kit for Mouse Vasorin

EK3852 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Vasorin in samples from serum, plasma, tissue homogenates and other biological fluids.

VASN ELISA Kit (Mouse) (OKCD09001)

OKCD09001 96 Wells
EUR 1001
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.060ng/mL

VASN ELISA Kit (Mouse) (OKEH01201)

OKEH01201 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

ELISA kit for Human Vasorin

EK3851 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Vasorin in samples from serum, plasma, tissue homogenates and other biological fluids.

VASN ELISA Kit (Human) (OKAN05668)

OKAN05668 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.113 ng/mL

VASN ELISA Kit (Human) (OKCD09000)

OKCD09000 96 Wells
EUR 975
Description: Description of target: VASN may act as an inhibitor of TGF-beta signaling.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL

VASN ELISA Kit (Human) (OKEH03392)

OKEH03392 96 Wells
EUR 662
Description: Description of target: May act as an inhibitor of TGF-beta signaling.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.177 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Mouse VASN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VASN Recombinant Protein (Mouse)

RP183656 100 ug Ask for price


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VASN Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:500-1:1000, IF:1:200-1:500

Vasn ORF Vector (Mouse) (pORF)

ORF061220 1.0 ug DNA
EUR 506

VASN cloning plasmid

CSB-CL025796HU-10ug 10ug
EUR 675
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2022
  • Sequence: atgtgctccagggtccctctgctgctgccgctgctcctgctactggccctggggcctggggtgcagggctgcccatccggctgccagtgcagccagccacagacagtcttctgcactgcccgccaggggaccacggtgccccgagacgtgccacccgacacggtggggctgtacg
  • Show more
Description: A cloning plasmid for the VASN gene.

VASN Polyclonal Antibody

ES10988-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VASN Polyclonal Antibody

ES10988-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VASN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VASN Polyclonal Antibody

ABP60871-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein

VASN Polyclonal Antibody

ABP60871-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein

VASN Polyclonal Antibody

ABP60871-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VASN protein
  • Applications tips:
Description: A polyclonal antibody for detection of VASN from Human, Mouse. This VASN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VASN protein

VASN Rabbit pAb

A16215-100ul 100 ul
EUR 308

VASN Rabbit pAb

A16215-200ul 200 ul
EUR 459

VASN Rabbit pAb

A16215-20ul 20 ul
EUR 183

VASN Rabbit pAb

A16215-50ul 50 ul
EUR 223

VASN Polyclonal Antibody

29780-100ul 100ul
EUR 252

VASN Polyclonal Antibody

29780-50ul 50ul
EUR 187

Recombinant human VASN

P1430 100ug Ask for price
  • Uniprot ID: Q6EMK4
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human VASN

Anti-VASN antibody

STJ118668 100 µl
EUR 277

Anti-VASN antibody

STJ192146 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VASN

Recombinant Human Vasorin Protein

RP01087 10 μg
EUR 190

Vasn sgRNA CRISPR Lentivector set (Mouse)

K4394901 3 x 1.0 ug
EUR 339

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

VASN Polyclonal Conjugated Antibody

C29780 100ul
EUR 397

Human VASN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VASN Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

VASN Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

VASN Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against VASN. Recognizes VASN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

VASN Recombinant Protein (Human)

RP034255 100 ug Ask for price

VASN Recombinant Protein (Rat)

RP236282 100 ug Ask for price

Vasn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4394902 1.0 ug DNA
EUR 154

Vasn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4394903 1.0 ug DNA
EUR 154

Vasn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4394904 1.0 ug DNA
EUR 154

VASN Protein Vector (Mouse) (pPB-C-His)

PV244878 500 ng
EUR 1065

VASN Protein Vector (Mouse) (pPB-N-His)

PV244879 500 ng
EUR 1065

VASN Protein Vector (Mouse) (pPM-C-HA)

PV244880 500 ng
EUR 1065

VASN Protein Vector (Mouse) (pPM-C-His)

PV244881 500 ng
EUR 1065

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

Vasn ORF Vector (Rat) (pORF)

ORF078762 1.0 ug DNA
EUR 506

VASN ORF Vector (Human) (pORF)

ORF011419 1.0 ug DNA
EUR 95

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

VASN sgRNA CRISPR Lentivector set (Human)

K2605901 3 x 1.0 ug
EUR 339

Vasn sgRNA CRISPR Lentivector set (Rat)

K6021801 3 x 1.0 ug
EUR 339

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

Vasn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4394905 3 x 1.0 ug
EUR 376

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

VASN sgRNA CRISPR Lentivector (Human) (Target 1)

K2605902 1.0 ug DNA
EUR 154

VASN sgRNA CRISPR Lentivector (Human) (Target 2)

K2605903 1.0 ug DNA
EUR 154

VASN sgRNA CRISPR Lentivector (Human) (Target 3)

K2605904 1.0 ug DNA
EUR 154

Vasn sgRNA CRISPR Lentivector (Rat) (Target 1)

K6021802 1.0 ug DNA
EUR 154

Vasn sgRNA CRISPR Lentivector (Rat) (Target 2)

K6021803 1.0 ug DNA
EUR 154

Vasn sgRNA CRISPR Lentivector (Rat) (Target 3)

K6021804 1.0 ug DNA
EUR 154

VASN Protein Vector (Human) (pPB-C-His)

PV045673 500 ng
EUR 329

VASN Protein Vector (Human) (pPB-N-His)

PV045674 500 ng
EUR 329

VASN Protein Vector (Human) (pPM-C-HA)

PV045675 500 ng
EUR 329

VASN Protein Vector (Human) (pPM-C-His)

PV045676 500 ng
EUR 329

VASN Protein Vector (Rat) (pPB-C-His)

PV315046 500 ng
EUR 1166

VASN Protein Vector (Rat) (pPB-N-His)

PV315047 500 ng
EUR 1166

VASN Protein Vector (Rat) (pPM-C-HA)

PV315048 500 ng
EUR 1166

VASN Protein Vector (Rat) (pPM-C-His)

PV315049 500 ng
EUR 1166

Vasn 3'UTR GFP Stable Cell Line

TU171732 1.0 ml Ask for price

VASN 3'UTR GFP Stable Cell Line

TU078056 1.0 ml
EUR 1394

Vasn 3'UTR Luciferase Stable Cell Line

TU121732 1.0 ml Ask for price

VASN 3'UTR Luciferase Stable Cell Line

TU028056 1.0 ml
EUR 1394

Vasn 3'UTR Luciferase Stable Cell Line

TU223006 1.0 ml Ask for price

Vasn 3'UTR GFP Stable Cell Line

TU273006 1.0 ml Ask for price

Vasn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4394906 1.0 ug DNA
EUR 167

Vasn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4394907 1.0 ug DNA
EUR 167

Vasn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4394908 1.0 ug DNA
EUR 167

VASN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV647353 1.0 ug DNA
EUR 1355

VASN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV647357 1.0 ug DNA
EUR 1355

VASN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV647358 1.0 ug DNA
EUR 1355

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

VASN sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2605905 3 x 1.0 ug
EUR 376

Vasn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6021805 3 x 1.0 ug
EUR 376


EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

VASN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2605906 1.0 ug DNA
EUR 167

VASN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2605907 1.0 ug DNA
EUR 167

VASN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2605908 1.0 ug DNA
EUR 167

Vasn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6021806 1.0 ug DNA
EUR 167

Vasn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6021807 1.0 ug DNA
EUR 167

Vasn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6021808 1.0 ug DNA
EUR 167

VASN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV647354 1.0 ug DNA
EUR 1355

VASN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV647355 1.0 ug DNA
EUR 1413

VASN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV647356 1.0 ug DNA
EUR 1413


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

KIT ELISA Kit (Mouse) (OKCD06004)

OKCD06004 96 Wells
EUR 779
Description: Description of target: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

Kit ELISA Kit (Mouse) (OKBB01105)

OKBB01105 96 Wells
EUR 505
Description: Description of target: SCFR(Mast/stem cell growth factor receptor), also known as proto-oncogene c-Kit or tyrosine-protein kinase Kit or CD117, is a protein that in humans is encoded by the KIT gene. KIT was first described as the cellular homolog of the feline sarcoma viral oncogene v-kit. The KIT gene is mapped on 4q12. Kit was expressed on the surface of germ cells up to the pachytene stage. Signaling from the KIT receptor tyrosine kinase is essential for primordial germ cell growth both in vivo and in vitro. Determination of the KIT effectors acting in primordial germ cells has been hampered by the lack of effective methods to manipulate easily gene expression in these cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Cygb ELISA Kit| Mouse Cytoglobin ELISA Kit

EF014614 96 Tests
EUR 689

Dfnb31 ELISA Kit| Mouse Whirlin ELISA Kit

EF014640 96 Tests
EUR 689

Dmkn ELISA Kit| Mouse Dermokine ELISA Kit

EF014677 96 Tests
EUR 689

Dstn ELISA Kit| Mouse Destrin ELISA Kit

EF014680 96 Tests
EUR 689

Dpys ELISA Kit| Mouse Dihydropyrimidinase ELISA Kit

EF014695 96 Tests
EUR 689

Mouse VASN(Vasorin) ELISA Kit