Rat CRN(Corin) ELISA Kit

Rat CRN(Corin) ELISA Kit

Rat Corin (CRN) ELISA Kit
RDR-CRN-Ra-96Tests 96 Tests
EUR 811

Rat Corin (CRN) ELISA Kit
RD-CRN-Ra-48Tests 48 Tests
EUR 557

Rat Corin (CRN) ELISA Kit
RD-CRN-Ra-96Tests 96 Tests
EUR 775

Human Corin (CRN) ELISA Kit
DLR-CRN-Hu-48T 48T
EUR 414
  • Should the Human Corin (CRN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Corin (CRN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Corin (CRN) ELISA Kit
DLR-CRN-Hu-96T 96T
EUR 533
  • Should the Human Corin (CRN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Corin (CRN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Corin (CRN) ELISA Kit
DLR-CRN-Mu-48T 48T
EUR 527
  • Should the Mouse Corin (CRN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Corin (CRN) in samples from serum, plasma or other biological fluids.

Mouse Corin (CRN) ELISA Kit
DLR-CRN-Mu-96T 96T
EUR 688
  • Should the Mouse Corin (CRN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Corin (CRN) in samples from serum, plasma or other biological fluids.

Human Corin (CRN) ELISA Kit
RDR-CRN-Hu-48Tests 48 Tests
EUR 423

Human Corin (CRN) ELISA Kit
RDR-CRN-Hu-96Tests 96 Tests
EUR 583

Mouse Corin (CRN) ELISA Kit
RDR-CRN-Mu-48Tests 48 Tests
EUR 557

Mouse Corin (CRN) ELISA Kit
RDR-CRN-Mu-96Tests 96 Tests
EUR 774

Human Corin (CRN) ELISA Kit
RD-CRN-Hu-48Tests 48 Tests
EUR 405

Human Corin (CRN) ELISA Kit
RD-CRN-Hu-96Tests 96 Tests
EUR 558

Mouse Corin (CRN) ELISA Kit
RD-CRN-Mu-48Tests 48 Tests
EUR 533

Mouse Corin (CRN) ELISA Kit
RD-CRN-Mu-96Tests 96 Tests
EUR 740

Rat Corin (CRN) ELISA Kit
20-abx155390
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Corin (CRN) ELISA Kit
SEG316Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Corin (CRN) in serum, plasma, tissue homogenates and other biological fluids.

Rat Corin (CRN) ELISA Kit
SEG316Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Corin (CRN) in serum, plasma, tissue homogenates and other biological fluids.

Rat Corin (CRN) ELISA Kit
SEG316Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Corin (CRN) in serum, plasma, tissue homogenates and other biological fluids.

Rat Corin (CRN) ELISA Kit
SEG316Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Corin (CRN) in serum, plasma, tissue homogenates and other biological fluids.

Rat Corin (CRN) ELISA Kit
4-SEG316Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Corin elisa. Alternative names of the recognized antigen: ATC2
  • CRN
  • Lrp4
  • TMPRSS10
  • Atrial Natriuretic Peptide-Converting Enzyme, Serine Protease
  • Heart-specific serine proteinase ATC2
  • Pro-ANP-converting enzyme
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Corin (CRN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat CRN (Corin)
ELK7112 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Corin (CRN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Corin (CRN). Next, Avi
  • Show more
Description: A sandwich ELISA kit for detection of Corin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Corin (CRN) CLIA Kit
20-abx495156
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Corin (CRN) Protein
20-abx066116
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Corin (CRN) ELISA Kit
20-abx153866
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Corin (CRN) ELISA Kit
20-abx151156
  • EUR 5640.00
  • EUR 3009.00
  • EUR 707.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human CRN(Corin) ELISA Kit
EH0097 96T
EUR 524.1
  • Detection range: 75-4800 pg/ml
  • Uniprot ID: Q9BZJ0
  • Alias: Corin/CRN/ATC2/Lrp4/PEE5/TMPRSS10/Atrial Natriuretic Peptide-Converting Enzyme
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 45pg/ml

Chicken Corin (CRN) ELISA Kit
abx354729-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Corin (CRN) ELISA Kit
abx355042-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Corin (CRN) ELISA Kit
abx355185-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Corin (CRN) ELISA Kit
abx355284-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Corin (CRN) ELISA Kit
abx570721-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Corin(CRN)ELISA Kit
QY-E01445 96T
EUR 361

Mouse Corin ELISA Kit (CRN)
RK02711 96 Tests
EUR 521

Human Corin (CRN) ELISA Kit
SEG316Hu-10x96wellstestplate 10x96-wells test plate
EUR 3487.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corin (CRN) in serum, plasma, tissue homogenates and other biological fluids.

Human Corin (CRN) ELISA Kit
SEG316Hu-1x48wellstestplate 1x48-wells test plate
EUR 374.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corin (CRN) in serum, plasma, tissue homogenates and other biological fluids.

Human Corin (CRN) ELISA Kit
SEG316Hu-1x96wellstestplate 1x96-wells test plate
EUR 492.7
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corin (CRN) in serum, plasma, tissue homogenates and other biological fluids.

Human Corin (CRN) ELISA Kit
SEG316Hu-5x96wellstestplate 5x96-wells test plate
EUR 1917.15
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Corin (CRN) in serum, plasma, tissue homogenates and other biological fluids.

Human Corin (CRN) ELISA Kit
4-SEG316Hu
  • EUR 3538.00
  • EUR 1868.00
  • EUR 493.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Corin elisa. Alternative names of the recognized antigen: ATC2
  • CRN
  • Lrp4
  • TMPRSS10
  • Atrial Natriuretic Peptide-Converting Enzyme, Serine Protease
  • Heart-specific serine proteinase ATC2
  • Pro-ANP-converting enzyme
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Corin (CRN) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Corin (CRN) ELISA Kit
SEG316Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Corin (CRN) in serum, plasma and other biological fluids.

Mouse Corin (CRN) ELISA Kit
SEG316Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Corin (CRN) in serum, plasma and other biological fluids.

Mouse Corin (CRN) ELISA Kit
SEG316Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Corin (CRN) in serum, plasma and other biological fluids.

Mouse Corin (CRN) ELISA Kit
SEG316Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Corin (CRN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Corin (CRN) in serum, plasma and other biological fluids.

Mouse Corin (CRN) ELISA Kit
4-SEG316Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Corin elisa. Alternative names of the recognized antigen: ATC2
  • CRN
  • Lrp4
  • TMPRSS10
  • Atrial Natriuretic Peptide-Converting Enzyme, Serine Protease
  • Heart-specific serine proteinase ATC2
  • Pro-ANP-converting enzyme
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Corin (CRN) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Corin (CRN) Antibody
20-abx100002
  • EUR 328.00
  • EUR 133.00
  • EUR 926.00
  • EUR 467.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Corin (CRN) Antibody
20-abx100003
  • EUR 328.00
  • EUR 133.00
  • EUR 926.00
  • EUR 467.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Corin (CRN) Antibody
20-abx100004
  • EUR 328.00
  • EUR 133.00
  • EUR 926.00
  • EUR 467.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Corin (CRN) Antibody
20-abx100005
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Corin (CRN) Antibody
20-abx100006
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Corin (CRN) Antibody
20-abx100007
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Corin (CRN) Antibody
20-abx130684
  • EUR 328.00
  • EUR 133.00
  • EUR 926.00
  • EUR 467.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Corin (CRN) Antibody
20-abx171922
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Corin (CRN) Antibody
20-abx171923
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Corin (CRN)
4-RPG316Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y5Q5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.6kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Corin expressed in: E.coli

Recombinant Corin (CRN)
4-RPG316Hu02
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y5Q5
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.9kDa
  • Isoelectric Point: 5.2
Description: Recombinant Human Corin expressed in: E.coli

Recombinant Corin (CRN)
4-RPG316Hu03
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y5Q5
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.1kDa
  • Isoelectric Point: 4.8
Description: Recombinant Human Corin expressed in: E.coli

Recombinant Corin (CRN)
4-RPG316Hu04
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y5Q5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.6kDa
  • Isoelectric Point: 6.5
Description: Recombinant Human Corin expressed in: E.coli

Recombinant Corin (CRN)
4-RPG316Mu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Z319
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.3kDa
  • Isoelectric Point: 6.1
Description: Recombinant Mouse Corin expressed in: E.coli

Recombinant Corin (CRN)
4-RPG316Mu02
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Z319
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: 4.8
Description: Recombinant Mouse Corin expressed in: E.coli

Recombinant Corin (CRN)
4-RPG316Ra01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q80YN4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.2kDa
  • Isoelectric Point: 6.1
Description: Recombinant Rat Corin expressed in: E.coli

Corin (CRN) Polyclonal Antibody (Rat)
4-PAG316Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Pro533~Gln634)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corin (CRN)

ELISA kit for Human CRN (Corin)
E-EL-H0042 1 plate of 96 wells
EUR 534
  • Gentaur's CRN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CRN. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CRN (Corin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human CRN (Corin)
ELK1327 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Corin (CRN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Corin (CRN). Next, Avi
  • Show more
Description: A sandwich ELISA kit for detection of Corin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Corin (CRN) ELISA Kit
abx354852-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Mouse CRN (Corin)
ELK6120 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Corin (CRN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Corin (CRN). Next, Avi
  • Show more
Description: A sandwich ELISA kit for detection of Corin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Corin (CRN) CLIA Kit
abx195211-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Corin (CRN) CLIA Kit
20-abx495154
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Corin (CRN) CLIA Kit
20-abx495155
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Corin (CRN) Protein
20-abx166452
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Corin (CRN) Protein
20-abx066119
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Corin (CRN) Protein
20-abx066120
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Corin (CRN) Protein
20-abx066121
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Corin (CRN) Protein
20-abx066122
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Corin (CRN) Protein
20-abx066123
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Corin (CRN) Antibody (Biotin)
20-abx273423
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Corin (CRN) Polyclonal Antibody (Rat), APC
4-PAG316Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Pro533~Gln634)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corin (CRN). This antibody is labeled with APC.

Corin (CRN) Polyclonal Antibody (Rat), Biotinylated
4-PAG316Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Pro533~Gln634)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corin (CRN). This antibody is labeled with Biotin.

Corin (CRN) Polyclonal Antibody (Rat), Cy3
4-PAG316Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Pro533~Gln634)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Rat), FITC
4-PAG316Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Pro533~Gln634)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corin (CRN). This antibody is labeled with FITC.

Corin (CRN) Polyclonal Antibody (Rat), HRP
4-PAG316Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Pro533~Gln634)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corin (CRN). This antibody is labeled with HRP.

Corin (CRN) Polyclonal Antibody (Rat), PE
4-PAG316Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Pro533~Gln634)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corin (CRN). This antibody is labeled with PE.

CLIA kit for Human CRN (Corin)
E-CL-H0042 1 plate of 96 wells
EUR 584
  • Gentaur's CRN CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human CRN . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human CRN (Corin) in samples from Serum, Plasma, Cell supernatant

Corin (CRN) Polyclonal Antibody (Human)
4-PAG316Hu02
  • EUR 206.00
  • EUR 1876.00
  • EUR 481.00
  • EUR 252.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser448~Glu579)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN)

Corin (CRN) Polyclonal Antibody (Human)
4-PAG316Hu03
  • EUR 206.00
  • EUR 1876.00
  • EUR 481.00
  • EUR 252.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Arg134~Pro573)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN)

Corin (CRN) Polyclonal Antibody (Human)
4-PAG316Hu04
  • EUR 206.00
  • EUR 1876.00
  • EUR 481.00
  • EUR 252.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Thr807~Thr1038)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN)

Corin (CRN) Polyclonal Antibody (Mouse)
4-PAG316Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser521~Thr637)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN)

Corin (CRN) Polyclonal Antibody (Mouse)
4-PAG316Mu02
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gln334~Ser477)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN)

Corin (CRN) Polyclonal Antibody (Human, Mouse, Rat)
4-PAG316Hu01
  • EUR 207.00
  • EUR 1889.00
  • EUR 484.00
  • EUR 253.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gly70~Thr136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Corin (CRN)

Corin (CRN) Polyclonal Antibody (Rat), APC-Cy7
4-PAG316Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Pro533~Gln634)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corin (CRN). This antibody is labeled with APC-Cy7.

Corin (CRN) Polyclonal Antibody (Human), APC
4-PAG316Hu02-APC
  • EUR 285.00
  • EUR 2411.00
  • EUR 696.00
  • EUR 353.00
  • EUR 193.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser448~Glu579)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with APC.

Corin (CRN) Polyclonal Antibody (Human), Biotinylated
4-PAG316Hu02-Biotin
  • EUR 267.00
  • EUR 1826.00
  • EUR 569.00
  • EUR 317.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser448~Glu579)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with Biotin.

Corin (CRN) Polyclonal Antibody (Human), Cy3
4-PAG316Hu02-Cy3
  • EUR 338.00
  • EUR 3173.00
  • EUR 887.00
  • EUR 429.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser448~Glu579)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Human), FITC
4-PAG316Hu02-FITC
  • EUR 248.00
  • EUR 1948.00
  • EUR 577.00
  • EUR 302.00
  • EUR 174.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser448~Glu579)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with FITC.

Corin (CRN) Polyclonal Antibody (Human), HRP
4-PAG316Hu02-HRP
  • EUR 263.00
  • EUR 2106.00
  • EUR 620.00
  • EUR 323.00
  • EUR 184.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser448~Glu579)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with HRP.

Corin (CRN) Polyclonal Antibody (Human), PE
4-PAG316Hu02-PE
  • EUR 248.00
  • EUR 1948.00
  • EUR 577.00
  • EUR 302.00
  • EUR 174.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser448~Glu579)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with PE.

Corin (CRN) Polyclonal Antibody (Human), APC
4-PAG316Hu03-APC
  • EUR 285.00
  • EUR 2411.00
  • EUR 696.00
  • EUR 353.00
  • EUR 193.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Arg134~Pro573)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with APC.

Corin (CRN) Polyclonal Antibody (Human), Biotinylated
4-PAG316Hu03-Biotin
  • EUR 267.00
  • EUR 1826.00
  • EUR 569.00
  • EUR 317.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Arg134~Pro573)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with Biotin.

Corin (CRN) Polyclonal Antibody (Human), Cy3
4-PAG316Hu03-Cy3
  • EUR 338.00
  • EUR 3173.00
  • EUR 887.00
  • EUR 429.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Arg134~Pro573)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Human), FITC
4-PAG316Hu03-FITC
  • EUR 248.00
  • EUR 1948.00
  • EUR 577.00
  • EUR 302.00
  • EUR 174.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Arg134~Pro573)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with FITC.

Corin (CRN) Polyclonal Antibody (Human), HRP
4-PAG316Hu03-HRP
  • EUR 263.00
  • EUR 2106.00
  • EUR 620.00
  • EUR 323.00
  • EUR 184.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Arg134~Pro573)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with HRP.

Corin (CRN) Polyclonal Antibody (Human), PE
4-PAG316Hu03-PE
  • EUR 248.00
  • EUR 1948.00
  • EUR 577.00
  • EUR 302.00
  • EUR 174.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Arg134~Pro573)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with PE.

Corin (CRN) Polyclonal Antibody (Human), APC
4-PAG316Hu04-APC
  • EUR 285.00
  • EUR 2411.00
  • EUR 696.00
  • EUR 353.00
  • EUR 193.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Thr807~Thr1038)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with APC.

Corin (CRN) Polyclonal Antibody (Human), Biotinylated
4-PAG316Hu04-Biotin
  • EUR 267.00
  • EUR 1826.00
  • EUR 569.00
  • EUR 317.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Thr807~Thr1038)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with Biotin.

Corin (CRN) Polyclonal Antibody (Human), Cy3
4-PAG316Hu04-Cy3
  • EUR 338.00
  • EUR 3173.00
  • EUR 887.00
  • EUR 429.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Thr807~Thr1038)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Human), FITC
4-PAG316Hu04-FITC
  • EUR 248.00
  • EUR 1948.00
  • EUR 577.00
  • EUR 302.00
  • EUR 174.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Thr807~Thr1038)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with FITC.

Corin (CRN) Polyclonal Antibody (Human), HRP
4-PAG316Hu04-HRP
  • EUR 263.00
  • EUR 2106.00
  • EUR 620.00
  • EUR 323.00
  • EUR 184.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Thr807~Thr1038)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with HRP.

Corin (CRN) Polyclonal Antibody (Human), PE
4-PAG316Hu04-PE
  • EUR 248.00
  • EUR 1948.00
  • EUR 577.00
  • EUR 302.00
  • EUR 174.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Thr807~Thr1038)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with PE.

Corin (CRN) Polyclonal Antibody (Mouse), APC
4-PAG316Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser521~Thr637)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with APC.

Corin (CRN) Polyclonal Antibody (Mouse), Biotinylated
4-PAG316Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser521~Thr637)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with Biotin.

Corin (CRN) Polyclonal Antibody (Mouse), Cy3
4-PAG316Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser521~Thr637)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Mouse), FITC
4-PAG316Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser521~Thr637)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with FITC.

Corin (CRN) Polyclonal Antibody (Mouse), HRP
4-PAG316Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser521~Thr637)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with HRP.

Corin (CRN) Polyclonal Antibody (Mouse), PE
4-PAG316Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser521~Thr637)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with PE.

Corin (CRN) Polyclonal Antibody (Mouse), APC
4-PAG316Mu02-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gln334~Ser477)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with APC.

Corin (CRN) Polyclonal Antibody (Mouse), Biotinylated
4-PAG316Mu02-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gln334~Ser477)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with Biotin.

Corin (CRN) Polyclonal Antibody (Mouse), Cy3
4-PAG316Mu02-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gln334~Ser477)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Mouse), FITC
4-PAG316Mu02-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gln334~Ser477)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with FITC.

Corin (CRN) Polyclonal Antibody (Mouse), HRP
4-PAG316Mu02-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gln334~Ser477)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with HRP.

Corin (CRN) Polyclonal Antibody (Mouse), PE
4-PAG316Mu02-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gln334~Ser477)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with PE.

Corin/ Rat Corin ELISA Kit
ELI-06201r 96 Tests
EUR 886

Corin (CRN) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAG316Hu01-APC
  • EUR 286.00
  • EUR 2429.00
  • EUR 701.00
  • EUR 355.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gly70~Thr136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Corin (CRN). This antibody is labeled with APC.

Corin (CRN) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAG316Hu01-Biotin
  • EUR 268.00
  • EUR 1839.00
  • EUR 572.00
  • EUR 318.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gly70~Thr136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Corin (CRN). This antibody is labeled with Biotin.

Corin (CRN) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAG316Hu01-Cy3
  • EUR 339.00
  • EUR 3197.00
  • EUR 893.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gly70~Thr136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAG316Hu01-FITC
  • EUR 248.00
  • EUR 1963.00
  • EUR 580.00
  • EUR 304.00
  • EUR 175.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gly70~Thr136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Corin (CRN). This antibody is labeled with FITC.

Corin (CRN) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAG316Hu01-HRP
  • EUR 264.00
  • EUR 2121.00
  • EUR 624.00
  • EUR 324.00
  • EUR 185.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gly70~Thr136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Corin (CRN). This antibody is labeled with HRP.

Corin (CRN) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAG316Hu01-PE
  • EUR 248.00
  • EUR 1963.00
  • EUR 580.00
  • EUR 304.00
  • EUR 175.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gly70~Thr136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Corin (CRN). This antibody is labeled with PE.

Corin (CRN) Polyclonal Antibody (Human), APC-Cy7
4-PAG316Hu02-APC-Cy7
  • EUR 450.00
  • EUR 4702.00
  • EUR 1273.00
  • EUR 587.00
  • EUR 266.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser448~Glu579)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with APC-Cy7.

Corin (CRN) Polyclonal Antibody (Human), APC-Cy7
4-PAG316Hu03-APC-Cy7
  • EUR 450.00
  • EUR 4702.00
  • EUR 1273.00
  • EUR 587.00
  • EUR 266.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Arg134~Pro573)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with APC-Cy7.

Corin (CRN) Polyclonal Antibody (Human), APC-Cy7
4-PAG316Hu04-APC-Cy7
  • EUR 450.00
  • EUR 4702.00
  • EUR 1273.00
  • EUR 587.00
  • EUR 266.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Thr807~Thr1038)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with APC-Cy7.

Corin (CRN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG316Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser521~Thr637)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with APC-Cy7.

Corin (CRN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG316Mu02-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gln334~Ser477)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with APC-Cy7.

Corin (CRN) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAG316Hu01-APC-Cy7
  • EUR 452.00
  • EUR 4738.00
  • EUR 1282.00
  • EUR 590.00
  • EUR 268.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gly70~Thr136)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Corin (CRN). This antibody is labeled with APC-Cy7.

CORIN ELISA Kit (Rat) (OKCD02352)
OKCD02352 96 Wells
EUR 896
Description: Description of target: Serine-type endopeptidase involved in atrial natriuretic peptide hormone (NPPA) processing. Converts through proteolytic cleavage the non-functional propeptide NPPA into the active hormone, thereby regulating blood pressure in heart and promoting natriuresis, diuresis and vasodilation. Proteolytic cleavage of pro-NPPA also plays a role in female pregnancy by promoting trophoblast invasion and spiral artery remodeling in uterus. Also acts as a regulator of sodium reabsorption in kidney. May also process pro-NPPB the B-type natriuretic peptide.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL

CRN ELISA KIT|Human
EF000077 96 Tests
EUR 689

Human CORIN ELISA Kit
ELA-E1930h 96 Tests
EUR 824

Human CORIN ELISA KIT
ELI-06202h 96 Tests
EUR 824

Mouse Corin ELISA KIT
ELI-06203m 96 Tests
EUR 865

CORIN ELISA KIT|Human
EF004787 96 Tests
EUR 689

Human Corin ELISA Kit
CSB-E17447h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Corin in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Corin ELISA Kit
1-CSB-E17447h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Corin in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Corin
HY-111048 5mg
EUR 681

ELISA kit for Human Corin
EK5572 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Corin in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Corin PicoKine ELISA Kit
EK1283 96 wells
EUR 425
Description: For quantitative detection of human Corin in cell culture supernates, serum and plasma(heparin, EDTA).

CORIN ELISA Kit (Mouse) (OKCD02463)
OKCD02463 96 Wells
EUR 857
Description: Description of target: Serine-type endopeptidase involved in atrial natriuretic peptide hormone (NPPA) processing. Converts through proteolytic cleavage the non-functional propeptide NPPA into the active hormone, thereby regulating blood pressure in heart and promoting natriuresis, diuresis and vasodilation. Proteolytic cleavage of pro-NPPA also plays a role in female pregnancy by promoting trophoblast invasion and spiral artery remodeling in uterus. Also acts as a regulator of sodium reabsorption in kidney. May also process pro-NPPB the B-type natriuretic peptide.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

CORIN ELISA Kit (Human) (OKBB00933)
OKBB00933 96 Wells
EUR 505
Description: Description of target: Atrial natriuretic peptide-converting enzyme, also called CRN or ATC2, is a protein that in humans is encoded by the CORIN gene. It is mapped to 4p12. This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. It has been found that Corin is the pro-ANP-converting enzyme and that Corin-mediated pro-ANP activation may play a role in regulating blood pressure. What’s more, Corin and ANP are essential for physiologic changes at the maternal-fetal interface. This protein may also function as a pro-brain-type natriuretic peptide convertase. Corin gene mutations which cause Corin to impair activity might be an underlying mechanism in hypertension.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CORIN ELISA Kit (Human) (OKCD08908)
OKCD08908 96 Wells
EUR 622
Description: Description of target: CORIN is a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. CORIN converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

Rat CORIN shRNA Plasmid
20-abx988401
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CORIN antibody
70R-1759 100 ug
EUR 377
Description: Rabbit polyclonal CORIN antibody raised against the C terminal of CORIN

CORIN Antibody
1-CSB-PA896913ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CORIN. Recognizes CORIN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CORIN Antibody
1-CSB-PA896913ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CORIN. Recognizes CORIN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Corin siRNA
20-abx901202
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Corin siRNA
20-abx912557
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Corin siRNA
20-abx912558
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-Corin
YF-PA25645 50 ul
EUR 334
Description: Mouse polyclonal to Corin

Rat Corin (Atrial natriuretic peptide converting enzyme) ELISA kit
E02C0019-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Corin (Atrial natriuretic peptide converting enzyme) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Corin (Atrial natriuretic peptide converting enzyme) ELISA kit
E02C0019-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Corin (Atrial natriuretic peptide converting enzyme) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Corin (Atrial natriuretic peptide converting enzyme) ELISA kit
E02C0019-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Corin (Atrial natriuretic peptide converting enzyme) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Corin ELISA Kit| Rat Atrial natriuretic peptide-converting enzy
EF018505 96 Tests
EUR 689

Rat Atrial natriuretic peptide-converting enzyme(CORIN) ELISA kit
CSB-EL005812RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Atrial natriuretic peptide-converting enzyme (CORIN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Atrial natriuretic peptide-converting enzyme(CORIN) ELISA kit
1-CSB-EL005812RA
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Atrial natriuretic peptide-converting enzyme(CORIN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Atrial Natriuretic Peptide-Converting Enzyme (CORIN) ELISA Kit
abx518863-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5 1
EUR 1138

Corin ORF Vector (Rat) (pORF)
ORF065322 1.0 ug DNA
EUR 506

Rat Carbonyl reductase [NADPH] 1 (CBR1/CBR/CRN) ELISA kit
E02C1411-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carbonyl reductase [NADPH] 1 (CBR1/CBR/CRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carbonyl reductase [NADPH] 1 (CBR1/CBR/CRN) ELISA kit
E02C1411-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carbonyl reductase [NADPH] 1 (CBR1/CBR/CRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carbonyl reductase [NADPH] 1 (CBR1/CBR/CRN) ELISA kit
E02C1411-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carbonyl reductase [NADPH] 1 (CBR1/CBR/CRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Corin ELISA Kit (Human) : 96 Wells (OKAG00213)
OKAG00213 96 Wells
EUR 596
Description: Description of target: This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 63 pg/mL

CORIN ELISA Kit (Human) : 96 Wells (OKEH02697)
OKEH02697 96 Wells
EUR 544
Description: Description of target: This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

ELISA kit for Rat Atrial natriuretic peptide-converting enzyme (CORIN)
KTE100904-48T 48T
EUR 332
  • Corin encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates bloo
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Atrial natriuretic peptide-converting enzyme (CORIN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Atrial natriuretic peptide-converting enzyme (CORIN)
KTE100904-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Corin encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates bloo
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Atrial natriuretic peptide-converting enzyme (CORIN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Atrial natriuretic peptide-converting enzyme (CORIN)
KTE100904-96T 96T
EUR 539
  • Corin encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates bloo
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Atrial natriuretic peptide-converting enzyme (CORIN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

CORIN Polyclonal Antibody
27422-100ul 100ul
EUR 252

CORIN Polyclonal Antibody
27422-50ul 50ul
EUR 187

CORIN Rabbit pAb
A10404-100ul 100 ul
EUR 308

CORIN Rabbit pAb
A10404-200ul 200 ul
EUR 459

CORIN Rabbit pAb
A10404-20ul 20 ul
EUR 183

CORIN Rabbit pAb
A10404-50ul 50 ul
EUR 223

CORIN Blocking Peptide
33R-3817 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CORIN antibody, catalog no. 70R-1759

CORIN cloning plasmid
CSB-CL896913HU-10ug 10ug
EUR 1120
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3129
  • Sequence: ATGAAACAGTCTCCTGCCCTCGCTCCGGAAGAGCGCTACCGCAGAGCCGGGTCCCCAAAGCCGGTCTTGAGAGCTGATGACAATAACATGGGCAATGGCTGCTCTCAGAAGCTGGCGACTGCTAACCTCCTCCGGTTCCTATTGCTGGTCCTGATTCCATGTATCTGTGCTCTCG
  • Show more
Description: A cloning plasmid for the CORIN gene.

Anti-CORIN antibody
STJ112440 100 µl
EUR 277
Description: This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Corin (5B6)
YF-MA17452 100 ug
EUR 363
Description: Mouse monoclonal to Corin

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

Corin sgRNA CRISPR Lentivector set (Rat)
K6703201 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Rat CRN(Corin) ELISA Kit