Rat SMTN(Smoothelin) ELISA Kit
Rat Smoothelin (SMTN) ELISA Kit |
RD-SMTN-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Rat Smoothelin (SMTN) ELISA Kit |
RDR-SMTN-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Smoothelin (SMTN) ELISA Kit |
RDR-SMTN-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Smoothelin (SMTN) ELISA Kit |
DLR-SMTN-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Smoothelin (SMTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Smoothelin (SMTN) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Smoothelin (SMTN) ELISA Kit |
DLR-SMTN-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Smoothelin (SMTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Smoothelin (SMTN) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Smoothelin (SMTN) ELISA Kit |
RD-SMTN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Smoothelin (SMTN) ELISA Kit |
RD-SMTN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Smoothelin (SMTN) ELISA Kit |
RDR-SMTN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Smoothelin (SMTN) ELISA Kit |
RDR-SMTN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Smoothelin (SMTN) ELISA Kit |
20-abx156101 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Smoothelin (SMTN) ELISA Kit |
SEC856Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Smoothelin (SMTN) ELISA Kit |
SEC856Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Smoothelin (SMTN) ELISA Kit |
SEC856Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Smoothelin (SMTN) ELISA Kit |
SEC856Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Smoothelin (SMTN) ELISA Kit |
4-SEC856Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Smoothelin elisa. Alternative names of the recognized antigen: SMSMO
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Smoothelin (SMTN) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
ELISA kit for Rat SMTN (Smoothelin) |
ELK6982 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Smoothelin (SMTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Smoothelin (SMTN
- Show more
|
Description: A sandwich ELISA kit for detection of Smoothelin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat Smoothelin (SMTN) Protein |
20-abx167608 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Smoothelin (SMTN) CLIA Kit |
20-abx493941 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Smoothelin (SMTN) ELISA Kit |
20-abx153124 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Smoothelin (SMTN) ELISA Kit |
abx390587-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Smoothelin (SMTN) ELISA Kit |
SEC856Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Smoothelin (SMTN) ELISA Kit |
SEC856Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Smoothelin (SMTN) ELISA Kit |
SEC856Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Smoothelin (SMTN) ELISA Kit |
SEC856Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids. |
Human Smoothelin (SMTN) ELISA Kit |
4-SEC856Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Smoothelin elisa. Alternative names of the recognized antigen: SMSMO
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Smoothelin (SMTN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Smoothelin (SMTN) Antibody |
20-abx128197 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Smoothelin (SMTN) Antibody |
20-abx130055 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Smoothelin (SMTN) Antibody |
20-abx006625 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Smoothelin (SMTN) Antibody |
20-abx174576 |
Abbexa |
|
|
|
Smoothelin (SMTN) Antibody |
20-abx174577 |
Abbexa |
|
|
|
Recombinant Smoothelin (SMTN) |
4-RPC856Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P53814
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 48.5kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Smoothelin expressed in: E.coli |
Recombinant Smoothelin (SMTN) |
4-RPC856Ra01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: D4ABA5
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 22.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Smoothelin expressed in: E.coli |
Smoothelin (SMTN) Polyclonal Antibody (Rat) |
4-PAC856Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln748~Val911)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN) |
ELISA kit for Human SMTN (Smoothelin) |
ELK4065 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Smoothelin (SMTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Smoothelin (SMTN
- Show more
|
Description: A sandwich ELISA kit for detection of Smoothelin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Smoothelin (SMTN) CLIA Kit |
20-abx493940 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Smoothelin (SMTN) Protein |
20-abx166596 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Anti-Smoothelin/SMTN Antibody |
A04895 |
BosterBio |
100ug/vial |
EUR 294 |
Smoothelin (SMTN) Polyclonal Antibody (Rat), APC |
4-PAC856Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln748~Val911)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with APC. |
Smoothelin (SMTN) Polyclonal Antibody (Rat), Biotinylated |
4-PAC856Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln748~Val911)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with Biotin. |
Smoothelin (SMTN) Polyclonal Antibody (Rat), Cy3 |
4-PAC856Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln748~Val911)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with Cy3. |
Smoothelin (SMTN) Polyclonal Antibody (Rat), FITC |
4-PAC856Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln748~Val911)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with FITC. |
Smoothelin (SMTN) Polyclonal Antibody (Rat), HRP |
4-PAC856Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln748~Val911)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with HRP. |
Smoothelin (SMTN) Polyclonal Antibody (Rat), PE |
4-PAC856Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln748~Val911)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with PE. |
Smoothelin (SMTN) Polyclonal Antibody (Human) |
4-PAC856Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln742~Arg906)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN) |
Smoothelin (SMTN) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC856Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln748~Val911)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with APC-Cy7. |
Smoothelin (SMTN) Polyclonal Antibody (Human), APC |
4-PAC856Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln742~Arg906)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with APC. |
Smoothelin (SMTN) Polyclonal Antibody (Human), Biotinylated |
4-PAC856Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln742~Arg906)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with Biotin. |
Smoothelin (SMTN) Polyclonal Antibody (Human), Cy3 |
4-PAC856Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln742~Arg906)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with Cy3. |
Smoothelin (SMTN) Polyclonal Antibody (Human), FITC |
4-PAC856Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln742~Arg906)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with FITC. |
Smoothelin (SMTN) Polyclonal Antibody (Human), HRP |
4-PAC856Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln742~Arg906)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with HRP. |
Smoothelin (SMTN) Polyclonal Antibody (Human), PE |
4-PAC856Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln742~Arg906)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with PE. |
Smoothelin (SMTN) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC856Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SMTN (Gln742~Arg906)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with APC-Cy7. |
SMTN ELISA Kit (Rat) (OKCD01249) |
OKCD01249 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.25 ng/mL |
SMTN ELISA Kit (Human) (OKCD00885) |
OKCD00885 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Structural protein of the cytoskeleton. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL |
Smoothelin Antibody |
20-abx141519 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Smoothelin antibody |
10R-8118 |
Fitzgerald |
100 ug |
EUR 467 |
Description: Mouse monoclonal Smoothelin antibody |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
SMTN siRNA |
20-abx934461 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SMTN siRNA |
20-abx934462 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Smtn ORF Vector (Rat) (pORF) |
ORF076722 |
ABM |
1.0 ug DNA |
EUR 506 |
SMTN cloning plasmid |
CSB-CL021855HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2748
- Sequence: atggcggacgaggccttagctgggctggatgagggagcccttcggaagctgctggaggtcacagcagatctggcagagcggcggcgcatccgctcagccatccgggaactgcagcggcaggagctggagcgcgaggaggaggccctggcatccaagcgtttccgtgccgagcggc
- Show more
|
Description: A cloning plasmid for the SMTN gene. |
SMTN Rabbit pAb |
A6745-100ul |
Abclonal |
100 ul |
EUR 308 |
SMTN Rabbit pAb |
A6745-200ul |
Abclonal |
200 ul |
EUR 459 |
SMTN Rabbit pAb |
A6745-20ul |
Abclonal |
20 ul |
EUR 183 |
SMTN Rabbit pAb |
A6745-50ul |
Abclonal |
50 ul |
EUR 223 |
Rat SMTN(Smoothelin) ELISA Kit