Rat SMTN(Smoothelin) ELISA Kit

Rat SMTN(Smoothelin) ELISA Kit

Rat Smoothelin (SMTN) ELISA Kit

RD-SMTN-Ra-96Tests 96 Tests
EUR 775

Rat Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Ra-48Tests 48 Tests
EUR 583

Rat Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Ra-96Tests 96 Tests
EUR 811

Human Smoothelin (SMTN) ELISA Kit

EUR 517
  • Should the Human Smoothelin (SMTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Smoothelin (SMTN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

EUR 673
  • Should the Human Smoothelin (SMTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Smoothelin (SMTN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

RD-SMTN-Hu-48Tests 48 Tests
EUR 521

Human Smoothelin (SMTN) ELISA Kit

RD-SMTN-Hu-96Tests 96 Tests
EUR 723

Human Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Hu-48Tests 48 Tests
EUR 544

Human Smoothelin (SMTN) ELISA Kit

RDR-SMTN-Hu-96Tests 96 Tests
EUR 756

Rat Smoothelin (SMTN) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

SEC856Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Rat Smoothelin (SMTN) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Smoothelin elisa. Alternative names of the recognized antigen: SMSMO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Smoothelin (SMTN) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat SMTN (Smoothelin)

ELK6982 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Smoothelin (SMTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Smoothelin (SMTN
  • Show more
Description: A sandwich ELISA kit for detection of Smoothelin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Smoothelin (SMTN) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Smoothelin (SMTN) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Smoothelin, Smtn ELISA KIT

ELI-19062m 96 Tests
EUR 865

Human Smoothelin, SMTN ELISA KIT

ELI-52975h 96 Tests
EUR 824

Human Smoothelin (SMTN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Smoothelin (SMTN) ELISA Kit

abx390587-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

SEC856Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Smoothelin (SMTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Smoothelin (SMTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Smoothelin (SMTN) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Smoothelin elisa. Alternative names of the recognized antigen: SMSMO
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Smoothelin (SMTN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Smoothelin(SMTN)ELISA Kit

QY-E04585 96T
EUR 361

Smoothelin (SMTN) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Smoothelin (SMTN) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Smoothelin (SMTN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Smoothelin (SMTN) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Smoothelin (SMTN) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Smoothelin (SMTN)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P53814
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 48.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Smoothelin expressed in: E.coli

Recombinant Smoothelin (SMTN)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4ABA5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Smoothelin expressed in: E.coli

Smoothelin (SMTN) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN)

ELISA kit for Human SMTN (Smoothelin)

ELK4065 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Smoothelin (SMTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Smoothelin (SMTN
  • Show more
Description: A sandwich ELISA kit for detection of Smoothelin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Smoothelin (SMTN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Smtn ELISA Kit| Mouse Smoothelin ELISA Kit

EF016229 96 Tests
EUR 689

Human Smoothelin (SMTN) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Anti-Smoothelin/SMTN Antibody

A04895 100ug/vial
EUR 294

Smoothelin (SMTN) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with APC.

Smoothelin (SMTN) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with Biotin.

Smoothelin (SMTN) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with Cy3.

Smoothelin (SMTN) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with FITC.

Smoothelin (SMTN) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with HRP.

Smoothelin (SMTN) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with PE.

Smoothelin (SMTN) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN)

Smoothelin (SMTN) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln748~Val911)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Smoothelin (SMTN). This antibody is labeled with APC-Cy7.

Smoothelin (SMTN) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with APC.

Smoothelin (SMTN) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with Biotin.

Smoothelin (SMTN) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with Cy3.

Smoothelin (SMTN) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with FITC.

Smoothelin (SMTN) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with HRP.

Smoothelin (SMTN) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with PE.

Smoothelin (SMTN) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SMTN (Gln742~Arg906)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Smoothelin (SMTN). This antibody is labeled with APC-Cy7.

SMTN ELISA Kit (Rat) (OKCD01249)

OKCD01249 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.25 ng/mL


EF005579 96 Tests
EUR 689

SMTN ELISA Kit (Human) (OKCD00885)

OKCD00885 96 Wells
EUR 831
Description: Description of target: Structural protein of the cytoskeleton. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.112 ng/mL

Smoothelin Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Smoothelin antibody

10R-8118 100 ug
EUR 467
Description: Mouse monoclonal Smoothelin antibody

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-Smoothelin antibody

STJ16100219 100 µg
EUR 446

Anti-Smoothelin antibody

STJ180240 0.1 ml
EUR 237

Smtn ORF Vector (Rat) (pORF)

ORF076722 1.0 ug DNA
EUR 506

SMTN cloning plasmid

CSB-CL021855HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2748
  • Sequence: atggcggacgaggccttagctgggctggatgagggagcccttcggaagctgctggaggtcacagcagatctggcagagcggcggcgcatccgctcagccatccgggaactgcagcggcaggagctggagcgcgaggaggaggccctggcatccaagcgtttccgtgccgagcggc
  • Show more
Description: A cloning plasmid for the SMTN gene.

SMTN Rabbit pAb

A6745-100ul 100 ul
EUR 308

SMTN Rabbit pAb

A6745-200ul 200 ul
EUR 459

SMTN Rabbit pAb

A6745-20ul 20 ul
EUR 183

SMTN Rabbit pAb

A6745-50ul 50 ul
EUR 223

Rat SMTN(Smoothelin) ELISA Kit